Información

Enzima anti tripsina

Enzima anti tripsina


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

En un paciente fumador, ¿el pulmón se digiere en exceso debido a una combinación de tabaquismo y un defecto en el gen de la antitripsina (evita la digestión de la proteasa)? ¿O el tabaquismo actúa igual que un paciente con un defecto en el gen?


Wikipedia tiene un buen artículo sobre la enfermedad.

https://en.wikipedia.org/wiki/Alpha_1-antitrypsin_deficiency

de ese artículo

La alfa-1 antitripsina (A1AT) se produce en el hígado y una de sus funciones es proteger los pulmones de la elastasa de neutrófilos, una enzima que puede alterar el tejido conectivo.

Las proteasas de neutrófilos están activas en cualquier lugar donde se encuentren los neutrófilos. Las personas que no fuman pueden contraer EPOC simplemente por tener la forma doble recesiva de esta enfermedad (sin alfa-1 antitripsina activa). Pero si ese es tu caso y también fumas, obtienes EPOC acelerada. La EPOC ya es una enfermedad inflamatoria asociada con la acción del moco y los neutrófilos y el daño que esto causa sin duda aumenta con la falta de alfa-1 antitripsina protectora.

Si padece esta afección, puede recibir infusiones de alfa-1 antitripsina, algo así como los diabéticos tipo 1 obtienen insulina.


1.18: Función enzimática

  • Contribuido por CK-12: Conceptos de biología
  • Procedente de la Fundación CK-12

¿Tienen las células una enzima con muchas funciones, o muchas enzimas, cada una con una sola función?

Enzimas Proteínas mágicas necesarias para la vida. Entonces, ¿cómo funcionan las enzimas? ¿Cómo catalizan solo una reacción bioquímica específica? En un rompecabezas, solo dos piezas encajarán correctamente. Comprender eso es uno de los pasos principales para comprender cómo funcionan las enzimas.


Causas

Mutaciones en el SERPINA1 gen causa deficiencia de alfa-1 antitripsina. Este gen proporciona instrucciones para producir una proteína llamada alfa-1 antitripsina, que protege al cuerpo de una poderosa enzima llamada elastasa de neutrófilos. La elastasa de neutrófilos se libera de los glóbulos blancos para combatir las infecciones, pero puede atacar los tejidos normales (especialmente los pulmones) si no se controla estrictamente con alfa-1 antitripsina.

Mutaciones en el SERPINA1 El gen puede provocar una escasez (deficiencia) de alfa-1 antitripsina o una forma anormal de la proteína que no puede controlar la elastasa de los neutrófilos. Sin suficiente alfa-1 antitripsina funcional, la elastasa de neutrófilos destruye los alvéolos y causa enfermedad pulmonar. La alfa-1 antitripsina anormal también puede acumularse en el hígado y dañar este órgano.

Es probable que los factores ambientales, como la exposición al humo del tabaco, los productos químicos y el polvo, afecten la gravedad de la deficiencia de alfa-1 antitripsina.

Obtenga más información sobre el gen asociado con la deficiencia de alfa-1 antitripsina


Tratamiento Tratamiento

En general, el tratamiento de los problemas médicos asociados con la deficiencia de alfa-1 antitripsina (AATD) incluye las terapias médicas estándar y la atención de apoyo para el problema médico específico. Sin embargo, hay una terapia especial disponible para algunas personas con DAAT que tienen problemas pulmonares llamada terapia de aumento (a veces llamada terapia de reemplazo). [2] [3] [5]

La terapia de aumento tiene como objetivo aumentar el nivel en sangre de la proteína alfa-1 antitripsina (AAT) mediante la adición de AAT humana purificada directamente en la sangre de la persona a través de una infusión intravenosa (IV). El objetivo es prevenir la progresión de la enfermedad pulmonar. Los problemas de la piel también suelen mejorar. La terapia de aumento no afecta la enfermedad hepática asociada con AATD. [2] [3] [5]


Enzimas en acción: cuantificación de proteínas de la leche

La tripsina es una enzima que hidroliza las proteínas en péptidos, listas para que otras enzimas las reduzcan a sus aminoácidos para su uso en el cuerpo. Las enzimas son catalizadores, lo que significa que ayudan o provocan una reacción sin que se consuman. La tripsina actúa en el intestino delgado, después de que el ácido y la pepsina en el estómago han comenzado a descomponer las proteínas.

Este experimento utiliza leche que contiene la proteína caseína. A medida que la caseína de la leche se descompone, las moléculas más pequeñas se vuelven solubles, lo que reduce la opacidad del líquido. El tiempo necesario para descomponer las moléculas se puede medir y la comparación de valores conocidos con valores desconocidos permitirá calcular las incógnitas. Como la leche no se aclarará del todo debido a la inevitable presencia de grasa, se introducirán algunos errores al variar las decisiones del punto final, no solo entre la clase, sino que cada alumno puede tener sus propias inconsistencias. En su lugar, se puede utilizar un colorímetro en modo de transmitancia para reducir este tipo de error, sin embargo, la evaluación visual debería ser suficiente para demostrar el principio básico. Este experimento comienza con concentraciones conocidas de leche desnatada en polvo. La concentración de proteína en sí se puede calcular si lo desea, a partir de la información del paquete de leche, hemos encontrado que la leche desnatada generalmente contiene alrededor de 9 g de proteína por 25 g de polvo (36%).

PREPARACIÓN: TÉCNICO DE LABORATORIO

  1. Disuelva 30 g de leche en polvo en 250 ml de agua destilada (dH2O)
  2. Agregue agua destilada para obtener 300 ml para una solución madre al 10%. (Ajuste según corresponda para el tamaño de su clase y 300 ml de stock deberían ser suficientes para 12 grupos con tolerancia para derrames). Diluir de la siguiente manera:
        • 5% estándar y ndash 75 ml de stock en 75 ml de dH2O
        • 4% estándar y 60 ml de stock en 90 ml de dH2O
        • 3% estándar y ndash 45 ml de stock en 105 ml de dH2O
        • 2% estándar y 30 ml de stock en 120 ml de dH2O
        • 1% estándar y 15 ml de stock en 135 ml de dH2O
        1. Utilice la leche restante para crear dos muestras desconocidas (X e Y) dentro del rango 1-5%, por ejemplo, 47 ml de stock en 103 ml de dH2O y 28 ml de stock en 122 ml de dH2O. Tome nota de la concentración pero no se la revele a los estudiantes.

        Solución madre de tripsina:

        1. Disuelva 1 g de tripsina en 100 ml de dH2O para hacer una solución al 1%.
        2. Ejecute un ensayo rápido (consulte el método a continuación) para asegurarse de que el estándar de proteína al 5% tardará entre 2 y 3 minutos en llegar al punto final.
        3. Si el momento es adecuado, disuelva 4 g de tripsina en 400 ml de dH2O para hacer el resto de la solución al 1%. Si es demasiado rápido o demasiado lento, ajuste la dilución adecuadamente.

        MÉTODO: ACTIVIDAD DEL ESTUDIANTE

        1. Etiquete sus tubos de ensayo 1%, 2%, 3%, 4%, 5%, X e Y.
        2. A cada tubo agregue 10 ml de la solución de leche adecuada.
        3. Marque una cruz negra, aproximadamente del tamaño del diámetro de sus tubos de ensayo, en el papel blanco.
        4. Al primer tubo (1%) agregue 5 ml de solución de tripsina. Inicie el temporizador y agite suavemente para mezclar. Si usa guantes, es posible que prefiera colocar el pulgar sobre la parte superior del tubo y mezclar invirtiendo el tubo, teniendo mucho cuidado de haber cubierto la parte superior por completo.
        5. Sostenga la cruz detrás del tubo de ensayo y registre el tiempo que tarda en hacerse visible.
        6. Repita con los tubos restantes y mantenga constante el punto en el que determina que la cruz sea visible.
        7. Trace los resultados de los estándares en su papel cuadriculado para verificar más fácilmente las anomalías. Si algún resultado parece fuera de lugar y necesita volver a ejecutar ese estándar, es mejor usar tubos de ensayo limpios ya que la enzima puede ser difícil de limpiar. Si necesita reutilizar un tubo, primero coloque los 5 ml de tripsina y encienda su temporizador desde el momento en que agrega la leche.
        8. Una vez que esté satisfecho de que su curva de calibración tiene sentido, grafique los resultados de sus dos incógnitas para estimar la concentración de leche en cada una.
        9. Los resultados de la clase se recopilarán y promediarán para hacer una curva de calibración agregada y una estimación. Considere lo que espera ver de los resultados agregados en comparación con los individuales.

        OBSERVACIONES Y RESULTADOS

        A continuación se muestra un ejemplo de los resultados esperados. Es una guía solo ya que los resultados individuales variarán.


        Semicuantificación de monómero y polímero alfa-1 antitripsina por separación centrífuga y ensayo por transferencia Western de componentes solubles e insolubles

        La deficiencia de alfa-1 antitripsina (a1AT), en su forma clásica, es una enfermedad autosómica recesiva asociada con un mayor riesgo de enfermedad hepática en adultos y niños, y con enfermedad pulmonar en adultos. La gran mayoría de las enfermedades hepáticas se asocian con la homocigosidad del alelo mutante Z, también llamado PiZZ. Este alelo homocigoto sintetiza grandes cantidades de proteína Z mutante a1AT en el hígado, pero la proteína mutante también se pliega incorrectamente durante la biogénesis. Como resultado, aproximadamente el 85% de las moléculas se retienen dentro de los hepatocitos en lugar de secretarse apropiadamente. El nivel en suero bajo o "deficiente" resultante deja a los pulmones vulnerables a la lesión inflamatoria de las proteasas de neutrófilos no inhibidos. La mayor parte de la proteína Z mutante retenida dentro de los hepatocitos se dirige a las vías de proteólisis intracelular, pero algunas moléculas permanecen en el retículo endoplásmico durante largos períodos de tiempo y otras adoptan una conformación inusual agregada o "polimerizada". Se cree que estos polímeros intracelulares desencadenan una cascada de lesión intracelular que puede conducir a una lesión hepática de órganos terminales que incluye hepatitis crónica, cirrosis y carcinoma hepatocelular. Está ampliamente aceptado que el factor que causa la enfermedad en la deficiencia de antitripsina Z-alfa-1 mutante (AATD-Z) es la acumulación tóxica de la proteína Z mutante. Dado que el plegado incorrecto de algunas pero no todas las proteínas Z durante su maduración conduce a la homopolimerización, sería muy útil un ensayo para evaluar la cantidad de ATZ normalmente plegada y ATZ polimérica acumulada. Aquí describimos un método para evaluar semicuantitativamente estas dos fracciones en una fuente de cultivo celular o de tejido.

        Palabras clave: AAT ATZ Agregación Alfa-1 antitripsina Cirrosis hepática Enfermedad hepática Polimerización de monómero-polímero Separación de proteínas solubles / insolubles Enfermedad de almacenamiento Mutante Z.


        ¿Cuáles son los síntomas de AATD?

        La deficiencia de alfa-1 antitripsina (AATD) puede presentarse como enfermedad pulmonar en adultos y puede estar asociada con enfermedad hepática en una pequeña porción de niños afectados. En los adultos afectados, los primeros síntomas de AATD son dificultad para respirar con actividad leve, capacidad reducida para hacer ejercicio y sibilancias. Estos síntomas suelen aparecer entre los 20 y los 40 años de edad. Otros signos y síntomas pueden incluir infecciones respiratorias repetidas, fatiga, taquicardia al ponerse de pie, problemas de visión y pérdida de peso involuntaria.

        Algunas personas con AATD tienen enfermedad pulmonar avanzada y enfisema, en el cual se dañan los pequeños sacos de aire (alvéolos) en los pulmones. Los síntomas del enfisema incluyen dificultad para respirar, tos seca y pecho en forma de barril. Fumar o exponerse al humo del tabaco aumenta la aparición de síntomas y daña los pulmones. Otros diagnósticos comunes incluyen EPOC (enfermedad pulmonar obstructiva crónica), asma, bronquitis crónica y bronquiectasia, una condición inflamatoria o degenerativa crónica de uno o más bronquios o bronquiolos.

        La enfermedad hepática, llamada cirrosis del hígado, es otro síntoma de AATD. Puede estar presente en algunos niños afectados, alrededor del 10 por ciento, y también se ha informado en el 15 por ciento de los adultos con AATD. En sus últimas etapas, los signos y síntomas de la enfermedad hepática pueden incluir hinchazón del abdomen, tos con sangre, hinchazón de pies o piernas y coloración amarillenta de la piel y el blanco de los ojos (ictericia).

        En raras ocasiones, la AATD puede causar una afección cutánea conocida como paniculitis, que se caracteriza por una piel endurecida con bultos o parches dolorosos. La paniculitis varía en gravedad y puede ocurrir a cualquier edad.

        La deficiencia de alfa-1 antitripsina (AATD) puede presentarse como enfermedad pulmonar en adultos y puede estar asociada con enfermedad hepática en una pequeña porción de niños afectados. En los adultos afectados, los primeros síntomas de AATD son dificultad para respirar con actividad leve, capacidad reducida para hacer ejercicio y sibilancias. Estos síntomas suelen aparecer entre los 20 y los 40 años de edad. Otros signos y síntomas pueden incluir infecciones respiratorias repetidas, fatiga, taquicardia al ponerse de pie, problemas de visión y pérdida de peso involuntaria.

        Algunas personas con AATD tienen enfermedad pulmonar avanzada y enfisema, en el cual se dañan los pequeños sacos de aire (alvéolos) en los pulmones. Los síntomas del enfisema incluyen dificultad para respirar, tos seca y pecho en forma de barril. Fumar o exponerse al humo del tabaco aumenta la aparición de síntomas y daña los pulmones. Otros diagnósticos comunes incluyen EPOC (enfermedad pulmonar obstructiva crónica), asma, bronquitis crónica y bronquiectasia, una afección inflamatoria o degenerativa crónica de uno o más bronquios o bronquiolos.

        La enfermedad hepática, llamada cirrosis del hígado, es otro síntoma de AATD. Puede estar presente en algunos niños afectados, alrededor del 10 por ciento, y también se ha informado en el 15 por ciento de los adultos con AATD. En sus últimas etapas, los signos y síntomas de la enfermedad hepática pueden incluir hinchazón del abdomen, tos con sangre, hinchazón de pies o piernas y coloración amarillenta de la piel y el blanco de los ojos (ictericia).

        En raras ocasiones, la AATD puede causar una afección cutánea conocida como paniculitis, que se caracteriza por una piel endurecida con bultos o parches dolorosos. La paniculitis varía en gravedad y puede ocurrir a cualquier edad.


        Enzimas: significado, mecanismo, clasificación, factores e importancia

        Hagamos un estudio en profundidad de las enzimas. Después de leer este artículo, aprenderá sobre: ​​1. Significado de las enzimas 2. Clasificación de enzimas 3. Mecanismo de acción enzimática 4. Factores que afectan la acción de las enzimas 5. Especificidad enzimática 6. Inhibición de enzimas y 7. Importancia diagnóstica de las enzimas.

        Significado de las enzimas:

        Las enzimas son biocatalizadores proteicos (e incluso ácidos nucleicos) que alteran (generalmente mejoran) la velocidad de una reacción.

        Energía libre de activación y efecto de catálisis:

        Una reacción química como sustrato a producto, tendrá lugar cuando un cierto número de moléculas de sustrato en cualquier instante, posean suficiente energía para alcanzar una condición activada llamada & # 8220 estado de transición & # 8221 en la cual la probabilidad de hacer o romper un enlace químico a forma el producto es muy alto. & # 8220 Energía libre de activación & # 8221 es la cantidad de energía necesaria para llevar todas las moléculas de un gramo mol de un sustrato a una temperatura determinada al estado de transición.

        En presencia de un catalizador, el sustrato se combina con él para producir un estado transitorio que tiene una energía de activación menor que la del sustrato solo. Esto acelera la reacción. Una vez que se forma el producto, la enzima (catalizador) puede combinarse con otra molécula del sustrato y repetir el proceso. Aunque hay un cambio en la energía libre de activación en presencia de una enzima, el cambio total de energía libre de la reacción permanece igual si la reacción es catalizada por una enzima o no.

        Clasificación de enzimas:

        La clasificación de enzimas se basa en:

        (2) La presencia o ausencia en un momento dado,

        (3) La regulación de la acción,

        (4) El lugar de acción y

        (5) Su importancia clínica.

        1. Clasificación basada en la reacción catalizada:

        Las enzimas se dividen ampliamente en seis grupos según el tipo de reacción catalizada.

        (a) Oxidorreductasas:

        Enzimas que provocan reacciones de oxidación y reducción.

        Ex. Piruvato + NADH: lactato deshidrogenasa → Lactato + NAD +

        Ácido glutámico + NAD: glutamato deshidrogenasa → α-cetoglutarato + NH3 + NADH

        Enzimas que catalizan la transferencia de grupos de un sustrato a otro, distintos del hidrógeno. Ex. La transaminasa cataliza la transferencia de un grupo amino de un aminoácido a un cetoácido para formar un nuevo cetoácido y un nuevo aminoácido.

        Ex. (α-cetoglutarato + alanina — alanina aminotransferasa → glutamato + piruvato

        Aspartato + α-cetoglutarato —aspartato aminotransferasa Oxaloacetato + Glutamato

        Aquellas enzimas que catalizan la rotura de enlaces con la adición de agua (hidrólisis). Todas las enzimas digestivas son hidrolasas. Ex. Pepsina, tripsina, amilasa, maltasa.

        Aquellas enzimas que catalizan la ruptura de un compuesto en dos sustancias por un mecanismo distinto a la adición de agua. El producto resultante siempre tiene un doble enlace.

        Ex. Fructosa-1-6-difosfato — ALDOLASA → Gliceraldehído-3-fosfato + DHAP

        Aquellas enzimas que catalizan la interconversión de isómeros ópticos y geométricos.

        Ex. Gliceraldehído-3-fosfato — ISOMERASA → Dihidroxiacetona fosfato

        Estas enzimas catalizan la unión de dos compuestos. Este es siempre un proceso que requiere energía (proceso activo).

        Ex. Piruvato + CO2 + ATP: piruvato carboxilasa Oxaloacetato + ADP + Pi

        2. Clasificación basada en la presencia o ausencia en un momento dado:

        Se identifican dos tipos:

        (a) Enzimas inducibles:

        Aquellas enzimas que son sintetizadas por la célula siempre que se requieren. La síntesis de estas enzimas generalmente requiere un inductor.

        Ex. Invertasa, HMG-CoA reductasa, p-galactosidasa y enzimas implicadas en el ciclo de la urea.

        (B) Enzimas constitutivas:

        Enzimas que están constantemente presentes en cantidades normales en el cuerpo, independientemente de los inductores.

        3. Clasificación basada en la regulación de la acción enzimática:

        Son de dos tipos:

        (a) Enzimas reguladoras:

        La acción de estas enzimas está regulada según el estado de la célula. La acción de las enzimas reguladoras aumenta o disminuye mediante un modulador en un sitio distinto del sitio activo denominado & # 8220 sitio alostérico & # 8221.

        Ex. Fosfofructoquinasa (PFK) y glutamato deshidrogenasa.

        (B) Enzimas no reguladoras:

        La acción de estas enzimas no está regulada.

        Ex. Succinato deshidrogenasa.

        4. Clasificación basada en el lugar de acción:

        Dependiendo de los dos sitios de acción, se dividen en:

        (a) Enzimas intracelulares:

        Las enzimas que son producidas por la célula y actúan dentro de la misma célula se conocen como enzimas intracelulares.

        Ex. Todas las enzimas de la glucólisis y el ciclo del TCA.

        (b) Enzimas extracelulares:

        Las enzimas producidas por una célula pero actúan fuera de esa célula independientemente de ella. Por ejemplo, todas las enzimas digestivas a saber. tripsina, lipasa pancreática, etc.

        5. Clasificación basada en su importancia clínica:

        (a) Enzimas plasmáticas funcionales:

        Las enzimas están presentes en el plasma en concentraciones considerablemente altas y son funcionales en el plasma debido a la presencia de su sustrato en el plasma.

        Ex. Lipasa sérica, enzimas de coagulación sanguínea.

        (B) Enzimas plasmáticas no funcionales:

        Las enzimas presentes en el plasma en concentraciones insignificantes y no tienen función en el plasma debido a la ausencia de su sustrato en él. Las enzimas plasmáticas no funcionales son de importancia diagnóstica.

        Las enzimas son nombradas con 4 dígitos por la comisión de nomenclatura de enzimas, donde la

        El 1er dígito se refiere a la clasificación principal

        El 2º dígito se refiere a la subclasificación.

        El tercer dígito se refiere a sub-subclasificación

        El cuarto dígito se refiere a esa enzima en particular

        Ex. 2.7.3.2 es adenosina trifosfato-creatina fosfotransferasa (creatina quinasa).

        Mecanismo de acción enzimática:

        Una enzima (o proteína) debe estar en su conformación nativa para ser biológicamente activa. La conformación tridimensional de las enzimas tiene un sitio particular donde el sustrato se une y se actúa sobre él, este sitio se denomina sitio activo.

        El sitio activo está destinado a dos áreas específicas:

        (1) Sitio de unión: donde el sustrato se une y

        (2) Sitio catalítico: donde tiene lugar la catálisis enzimática.

        Los aminoácidos presentes en el sitio activo son tirosina, histidina, cisteína, ácido glutámico, ácido aspártico, lisina y serina. En la aldolasa, la lisina está presente en el sitio activo. En la carboxipeptidasa, dos residuos de tirosina están presentes en el sitio activo. La ribonucleasa tiene dos histidinas en el sitio activo. Michaelis y Menten establecieron la teoría de la combinación de enzima con sustrato para formar el complejo enzima-sustrato. Según esto, la enzima se combina con el sustrato sobre el que actúa para formar un complejo enzima-sustrato. Luego, esta enzima se libera y el sustrato se descompone en el producto de la reacción.

        E [Enzima] + S [Sustrato] → ES [Complejo enzima-sustrato] → E + Producto

        El complejo ES también se denomina & # 8216Michaelis Menten complex & # 8217.

        Las enzimas aceleran la velocidad de la reacción química mediante cuatro mecanismos principales, a saber.

        1. Proximidad y Orientación:

        La enzima se une al sustrato de tal manera que el enlace susceptible está muy próximo al grupo catalítico y también orientado con precisión a él dando como resultado la catálisis.

        2. Modelo de deformación y distorsión o ajuste inducido:

        La unión del sustrato induce un cambio conformacional en la molécula de enzima que deforma la forma del sitio activo y también distorsiona el sustrato unido, provocando así la catálisis. La unión del sustrato a la enzima provocará un cambio en la estructura terciaria o cuaternaria de la molécula de la enzima, lo que desestabiliza la enzima. Para lograr la estabilidad, la enzima distorsiona el sustrato formando así el producto de reacción.

        3. Catálisis general ácido-base:

        El sitio activo de la enzima tiene aminoácidos que son buenos donantes de protones o aceptores de protones, lo que da como resultado una catálisis ácido-base del sustrato.

        4. Catálisis covalente:

        Algunas enzimas reaccionan con sus sustratos para formar complejos enzima-sustrato unidos covalentemente muy inestables, que experimentan una reacción adicional para formar los productos.

        Factores que afectan la acción de la enzima:

        Los factores que influyen en la velocidad de la reacción catalizada por enzimas son:

        3. Concentración de sustrato

        5. Concentración de productos

        1. Efecto de la temperatura:

        Cuando todos los demás parámetros se mantienen constantes (es decir, en su nivel óptimo), entonces la velocidad de la reacción enzimática aumenta lentamente con el aumento de temperatura hasta que alcanza un máximo. Un aumento adicional de la temperatura desnaturaliza la proteína, lo que da como resultado una disminución de la acción de la enzima y un aumento adicional de la temperatura puede destruir totalmente la proteína.

        La temperatura a la que la actividad enzimática es máxima se denomina temperatura óptima. La mayoría de las enzimas están totalmente inactivas entre 0 ° C y 4 ° C, su actividad comienza a los 10 ° C y aumenta lentamente hasta alcanzar su máxima capacidad a su temperatura óptima. La mayoría de las enzimas del cuerpo humano tienen sus temperaturas óptimas entre 37 ° C y 40 ° C.

        Más allá de esta temperatura, las enzimas se vuelven menos activas y pueden perder su actividad por completo a temperaturas más altas. En fiebre, el aumento de temperatura aumenta la actividad metabólica debido al aumento de la acción enzimática. La disminución de la temperatura conduce a hipotermia, que se observa en el trasplante de órganos y la cirugía a corazón abierto.

        Sin embargo, la vida existe en regiones muy frías y también en aguas termales, lo que indica que la misma enzima que existe en la célula humana, por ejemplo, las enzimas de la glucólisis y el ciclo del TCA, tienen sus temperaturas óptimas en temperaturas extremas.

        Por tanto, las bacterias de refrigeración existen con una temperatura óptima de sus enzimas cercana a los 4 ° C. Asimismo, las bacterias que sobreviven en aguas termales tienen las enzimas con temperaturas óptimas cercanas a los cien (s) grados Celsius ex. la temperatura óptima de la polimerasa Taq es 72 ° C.

        Coeficiente de Vant Hoffs:

        Es el coeficiente que explica que por cada 10 ° C de aumento de temperatura, la actividad enzimática aumenta 2 veces hasta que se alcanza la temperatura óptima.

        2. Efecto del pH:

        Cuando todos los demás parámetros se mantienen constantes, la velocidad de una reacción catalizada por enzimas aumenta hasta que alcanza el pH óptimo y luego disminuye con un aumento / disminución adicional del pH. La actividad es máxima para la mayoría de las enzimas a un pH biológico de 7,4. El pH óptimo para la pepsina es 1,5, la fosfatasa ácida es 4,5 y para la fosfatasa alcalina es 9,8.

        3. Efecto de la concentración de sustrato:

        Cuando todos los demás parámetros se mantienen constantes, incluida la concentración de enzima, entonces, a medida que aumenta la concentración de sustrato, la velocidad de reacción aumenta de manera constante, hasta que la enzima se satura con el sustrato. En esta etapa, la velocidad de reacción no aumenta y permanece constante. Cuando se traza un gráfico con la velocidad frente a la concentración de sustrato, se obtiene una curva hiperbólica.

        Esto se debe a que, a medida que aumenta la concentración de sustrato, las moléculas de sustrato se combinan con todas las moléculas de enzima disponibles en sus sitios activos hasta que no hay más sitios activos disponibles. Por lo tanto, en esta etapa, el sustrato solo repone los sitios cuando se liberan los productos y no puede aumentar la velocidad de reacción.

        Kmetro se define como la concentración de sustrato a la que la velocidad de la reacción catalizada por enzima es la mitad de la velocidad máxima.

        I. Un alto Kmetro El valor indica una unión débil entre la enzima y el sustrato.

        ii. Bajo Kmetro indica unión fuerte.

        Limitaciones de la ecuación de Michaelis-Menten:

        I. Esta ecuación permite el cálculo del valor aproximado de la velocidad máxima y no el valor exacto.

        ii. Es válido para las enzimas que solo tienen el sitio activo y no el sitio alostérico.

        iii. Calcula la Kmetro para reacciones mono-sustrato y no para reacciones multi-sustrato.

        iv. Se utiliza para conocer la velocidad de las enzimas no reguladoras pero no de las enzimas reguladoras.

        Con el fin de superar las limitaciones anteriores, se traza un diagrama de Tejedor de línea-Burke para establecer una relación entre los recíprocos de la concentración de sustrato y la velocidad.

        Trama Line Weaver-Burke:

        Al invertir la ecuación de Michaelis-Menten, obtenemos

        Mediante esta ecuación podemos calcular con precisión:

        I. La velocidad de cualquier reacción catalizada por enzimas.

        ii. La velocidad de reacción en la que está presente más de un sustrato.

        iii. La velocidad de todas las enzimas.

        Las enzimas reguladoras dan una curva sigmoidea y las enzimas no reguladoras dan una curva hiperbólica.

        4. Efecto de la concentración de enzimas:

        A medida que aumenta la concentración de enzima, la velocidad de reacción aumenta constantemente en presencia de una cantidad en exceso de sustrato, manteniéndose constantes los otros factores. Se produce una curva lineal.

        5. Efecto de los productos:

        Cuando el producto está más en la mezcla de reacción, la velocidad de reacción disminuye debido a la inhibición por retroalimentación.

        6. Efecto de la luz:

        La velocidad de actividad de varias enzimas cambia en diferentes longitudes de onda de luz, ej. la luz azul mejora la actividad de la amilasa salival, mientras que la luz U.V. la luz disminuye la velocidad.

        7. Efecto de los iones:

        La presencia o ausencia de iones particulares mejora o reduce la actividad de las enzimas ej. El pepsinógeno se convierte en pepsina en presencia de iones H +. Las quinasas actúan en presencia de iones Mg +2.

        Especificidad enzimática:

        Las enzimas son muy específicas en su reacción. Actúan sobre un sustrato en particular o catalizan una reacción en particular.

        En consecuencia, la especificidad enzimática es de dos tipos:

        1. Especificidad de la reacción:

        Estas enzimas son específicas para el tipo de reacción que catalizan, independientemente del sustrato sobre el que actúan. Por lo tanto, diferentes enzimas provocan diferentes reacciones en el mismo sustrato, es decir, las enzimas son específicas para una reacción en particular, sin importar qué sustrato pueda ser, por ejemplo. sobre los aminoácidos actúan tanto la aminoácido oxidasa que oxida los aminoácidos a cetoácidos como la descarboxilasa que elimina el dióxido de carbono de ellos.

        2. Especificidad del sustrato:

        Estas enzimas son específicas del sustrato sobre el que actúan. Esto se clasifica además de la siguiente manera.

        (a) Especificidad absoluta:

        Estas enzimas son muy específicas y actúan solo sobre un sustrato particular y ningún otro sustrato. Ex. Ureasa, catalasa, aspartasa.

        (B) Especificidad relativa:

        Estas enzimas actúan sobre un enlace en particular. Ex. D-aminoácido oxidasa.

        (C) Especificidad de grupo:

        Estas enzimas actúan sobre un solo grupo en particular.

        Es una enzima proteolítica que actúa sobre enlaces peptídicos aportados por aminoácidos aromáticos como tirosina, triptófano y fenilalanina.

        Es específico para aminoácidos básicos. Por lo tanto, escinde los enlaces peptídicos aportados por la lisina y la arginina.

        Actúa sobre el enlace peptídico cerca del extremo amino libre.

        Específico para grupo carboxílico libre.

        Específico para enlaces glicosídicos α-1 → 4.

        (D) Especificidad estéreo:

        Estas enzimas actúan sobre un estereoisómero particular.

        I. Succinato deshidrogenasa:

        Es específico para el estereoisómero fumarato, es decir, la forma cis del doble enlace.

        Es específico del enlace glucosídico β.

        iii. L-aminoácidos oxidasas:

        Actúa solo sobre los L-aminoácidos y no sobre los D-aminoácidos.

        Son compuestos orgánicos dializables no proteicos, termoestables y de bajo peso molecular que son necesarios para la acción de las enzimas. Generalmente las vitaminas actúan como coenzimas ej. biotina, piridoxina, etc. La enzima junto con una coenzima se conoce como & # 8216holoenzima & # 8217 y sin una coenzima es una & # 8216apoenzima & # 8217. Apoenzima (proteína) + Coenzima (no proteína) → Holoenzima (proteína enzimática activa).

        La holoenzima puede contener un compuesto orgánico o inorgánico (iones metálicos) o ambos. Si las sustancias orgánicas están presentes con enzimas, se las conoce como & # 8216coenzimas & # 8217 y si las sustancias inorgánicas actúan con las enzimas, se denominan & # 8216co-factores & # 8217 (Mg, Mn, Zn, Co, Se , etc.).

        El papel de las coenzimas es:

        (i) Actúan como cosustrato o segundo sustrato ej. Piruvato + NADH → Lactato + NAD +. NADH actúa como coenzima o segundo sustrato,

        (ii) Ayudan en la transferencia de grupos, ya sea hidrógeno o grupos distintos del hidrógeno, y

        (iii) La actividad específica de una coenzima es el número de unidades de coenzima presentes en un miligramo de proteína enzimática.

        Unidad o actividad enzimática:

        Una unidad de actividad enzimática es la cantidad de enzima que convierte 1.0 (J.M del sustrato por minuto en los productos a 25 ° C.

        Actividad específica de una enzima:

        Se define como el número de unidades de enzima por miligramo de proteína.

        Número de rotación de enzimas:

        El número de moléculas de sustrato transformadas por minuto (unidad de tiempo) por una sola enzima se conoce como número de renovación de la enzima. La anhidrasa carbónica tiene el número de rotación más alto de 36.000.000.

        Reacción de primer y segundo orden:

        Una reacción en la que solo hay un sustrato se denomina reacción de primer orden. Una reacción en la que están involucrados dos sustratos para formar un producto se denomina reacción de segundo orden, también conocida como reacción bisustrato. Esto implica un desplazamiento simple (es decir, ambos sustratos se unen a dos sitios activos en la enzima al mismo tiempo) o un desplazamiento doble (desplazamiento de ping-pong, en el que solo un sustrato se une al sitio activo de la enzima en un momento dado, una vez que se libera). el otro sustrato se une).

        La forma inactiva de una enzima se conoce como zimógeno o proenzima. El pepsinógeno y el tripsinógeno son los cimógenos de la pepsina y la tripsina, respectivamente.

        Los ácidos ribonucleicos que catalizan una reacción similar a la de las enzimas se conocen como ribozimas. Estas ribozimas ayudan en el procesamiento del ARN recién transcrito ex. ARN nuclear pequeño (SnRNA) y ARN hetero-nuclear (hnRNA).

        Inhibición de enzimas:

        La alteración de la actividad enzimática por sustancias específicas distintas de las no específicas como el pH, la temperatura, etc. se denomina inhibición enzimática.

        Hay dos tipos de inhibiciones enzimáticas:

        1. Inhibición enzimática irreversible:

        La actividad de la enzima se inhibe por la unión covalente del inhibidor en el sitio activo. El enlace inhibidor de la enzima no se puede disociar, por lo que es permanente e irreversible, es decir, no se puede revertir.

        I. La aldolasa es inhibida permanentemente por el yodoacetato.

        ii. Diisopropilurofosfato (DFP), un componente del gas nervioso, inhibe la mayoría de las enzimas digestivas de forma permanente en los seres humanos. Por eso es muy venenoso.

        iii. El benzoato paracloromercúrico (PCMB) inhibe las enzimas hexoquinasa y ureasa de forma irreversible.

        iv. Los reactivos orgánicos como los reactivos alcaloides inhiben las enzimas de forma irreversible.

        2. Inhibición enzimática reversible:

        Los inhibidores se unen de forma reversible a la enzima, por lo que no es permanente. La inhibición se puede revertir mediante varios mecanismos.

        (a) Inhibición enzimática competitiva:

        Es un tipo de inhibición reversible en la que existe competencia entre el sustrato y el inhibidor por el sitio activo de una enzima debido a la similitud estructural. Todas las enzimas no reguladoras muestran inhibición competitiva. Clinically competitive enzyme inhibition is of great importance since most of the drugs act by competitive inhibition.

        (i) The enzyme succinate dehydrogenase’s (SDH) substrate is succinic acid and the competitive inhibitors are oxalic acid, mallonic acid and glutaric acid. Among these, mallonic acid is the most potent competitive inhibitor of SDH.

        (ii) Folic acid, a vitamin for human beings has para-amino benzoic acid (PABA) as one of its components. Whereas it is not a vitamin for microorganisms i.e., they cannot utilize preformed folic acid from external source, instead they synthesize their own folic acid from aba. Sulpha drugs contain para-amino sulphonate which is structurally similar to PABA and hence competes for the enzyme active site of folic acid synthesis in microorganisms. If excess dose of sulpha drug is given, it results in inhibition of folic acid synthesis thus acting as an antibiotic. Human beings are not affected, because they do not synthesize folic acid.

        (iii) Methanol is acted upon by the enzyme alcohol dehydrogenase forming formaldehyde which is highly poisonous. If ethanol if given to methanol intoxicated patients then ethanol competitively binds to alcohol dehydrogenase thereby preventing formation of formaldehyde.

        (iv) Allopurinol is the competitive inhibitor of the enzyme xanthine oxidase whose substrate is hypoxanthine. Allopurinol prevents the formation of uric acid by competitive inhibition because it has structural similarity to hypoxanthine. This principle is used in the treatment of gout i.e. abnormal accumulation of uric acid crystals in the joint causing inflammation.

        (v) Glaucoma is a condition in which there is accumulation of fluid in the lens resulting in enlargement of eye. This can be treated with ‘acetazolamide’ which inhibits the enzyme carbonic anhydrase competitively. This prevents water formation and subsequent release of more water through the urine.

        (b) Non-competitive enzyme inhibition:

        It is shown by regulatory enzymes, also called allosteric enzymes.

        These are the enzymes that contain a site other than the active site which is called ‘allosteric site’. The action of some enzymes is regulated by ‘effectors’ which can bind reversibly to the enzyme molecule at specific sites other than the substrate binding site called the modulator site or the allosteric site.

        There is no competition between substrate and inhibitor for the active site since the inhibitor or modulator binds at the modulator site or allosteric site. If the binding of the effector causes inhibition of the enzyme action then it is called a negative effector and the process is called ‘allosteric inhibition’.

        If the enzyme reaction is activated by a modulator then it is called a positive modulator or effector and the process is called ‘allosteric activation’.

        Ex. Phosphofructo kinase (PFK) is an allosteric enzyme of the glycolytic pathway.

        The positive modulators of this enzyme are AMP and ADP.

        The negative modulators of PFK are ATP and citrate.

        These are substances (generally proteinacious in nature) that inhibit most of the digestive enzymes, ex. certain roundworms and hookworms survive in the intestine by secreting anti enzymes. Uncooked rice contains certain proteins that act as anti enzymes.

        Reversible covalent modification:

        Enzyme activity can be regulated by reversible covalent modification.

        It is regulated by cyclic inter-conversion of enzyme into two forms:

        The inter-conversion is brought about by a ‘converting enzyme’. The process of activation and inactivation of the enzyme is generally brought about by covalent phosphorylation or de-phosphorylation of the target enzyme. For example hormones like epinephrine, glucagon etc. bind to the hormone receptor site on the cell membrane and activate the enzyme adenyl cyclase, which in turn converts ATP to cyclic AMP (cAMP). This cAMP converts inactive protein kinase to active protein kinase (‘a’ form). This protein kinase phosphorylates many enzymes in the cell, some of which become active and yet some others become inactive.

        The inactive phosphorylase (‘b’ form) gets converted to active phosphorylase (‘a’ form) upon phosphorylation and affects the breakdown of glycogen to glucose. On the other hand glycogen synthase becomes inactive upon phosphorylation thereby inhibiting the formation of glycogen.

        Diagnostic Importance of Enzymes:

        Enzymes were classified into two groups based upon their clinical importance as ‘functional plasma enzymes’ i.e., those enzymes present in the plasma in considerably high amounts and are functional in the plasma due to the presence of their substrate in it.

        Ex. serum lipase, blood clotting enzymes, and ‘non-­functional plasma enzymes’ i.e., those enzymes that are present in the plasma in negligible amounts and have no function in the plasma due to the absence of their substrate in it. Non-functional plasma enzymes are of diagnostic importance.

        The non-functional plasma enzymes are present in higher concentration in tissues and very low concentration in the plasma i.e. in trace amounts, but their concentration in plasma increases immediately following tissue injury or destruction.

        If there is tissue damage leading to cell rupture then the enzymes present in that tissue leaks into the blood leading to the increase in the concentration of these enzymes in the plasma. Increase in the level of non-functional plasma enzymes in the blood, indicates the disorder to the tissue where they exist. Different enzymes exist in different tissues in varying levels. Damage to a specific tissue releases a particular enzyme. Therefore estimation of enzymes in the plasma has a diagnostic importance.

        The non-functional plasma enzymes include lactate dehydrogenase (LDH), creatine phosphokinase (CPK), alanine amino transferase (ALT) or serum glutamate pyruvate transaminase (SGPT), aspartate transaminase (AST) or serum glutamate oxaloacetate transaminase (SGOT), sorbitol dehydrogenase, alkaline phosphatase, acid phosphatase, amylase, pancreatic lipase etc.

        However functional plasma enzymes are already in higher concentration in the plasma, hence their decrease in the concentration in the plasma indicates malfunction of the organ where they are synthesized ex. blood clotting enzymes are synthesized in the liver hence decrease in their concentration indicates liver dysfunction.

        Anyway an immediate assessment of the liver function cannot be made by this assessment because by the time the enzyme concentration in the plasma decreases (may take 4 to 5 days), the liver must have regained its normal vitality.

        Diagnosis of Myocardial Infarction using Enzyme Assay:

        There are three main enzymes that are used in the diagnosis of myocardial infarction (1) Lactate dehydrogenase (LDH) (2) Creatine phosphokinase (CPK)—marker enzyme and (3) Transaminase (AST or SGOT).

        (1) Lactate dehydrogenase (LDH):

        LDH catalyses the inter conversion of pyruvate to lactate, a very important reaction of anaerobic glycolysis. Glycolysis occurs in each and every cell, in some cells it is always anaerobic (RBC) whereas in others it is aerobic sometimes and anaerobic at some other time (muscle tissue, liver, kidney etc.).

        In other words LDH is present in each and every cell of the body. Therefore damage to any of the tissues of the body results in release of LDH into the plasma. Hence it becomes a difficult task to trace out the organ from which it has leaked.

        However LDH exists in five isoenzyme forms i.e. multiple forms of the same enzyme (These enzymes bring about the same reaction but exhibit different physical characters like molecular weight, charge, electrophoretic mobility, Kmetro and isoelectric pH). The polypeptides in LDH are designated as ‘H chain’ and ‘M chain’.

        All the isoenzyme forms of LDH are tetramer i.e. has four polypeptides in the following combinations:

        (e) M4 or LDH5—Liver and skeletal muscle

        All these isomers have been successfully separated on Sodium Dodecyl Sulphate Polyacryl Amide Gel Electrophoresis (SDS-PAGE) and their banding pattern from the plasma is established as under—

        LDH1 or H4 is predominantly present in the cardiac muscle, whereas the isoenzyme form LDH5 or M4 is more abundant in the skeletal muscle. These two enzymes have different Km values and Km is indirectly proportional to affinity (Kmetro a 1/affinity).

        The skeletal muscle enzyme M4 has low Kmetro value for pyruvate and hence greater affinity for pyruvate resulting in high rate of conversion of pyruvate to lactate. The cardiac isoenzyme LDH1 or H4 has high Kmetro value for pyruvate hence lesser affinity for pyruvate, therefore low rate of conversion of pyruvate to lactate. Thus the concentration of H4 or LDH1 isoenzyme form of lactate dehydrogenase increases in the plasma during myocardial infarction. The peak levels of LDH are maintained in the plasma for 6 days following the attack, after which it starts receding in its concentration.

        (2) Creatine phosphokinase (CPK):

        This is known as the marker enzyme for the diagnosis of myocardial infarction or heart attack, because this is the first enzyme to increase within a short time in the blood plasma following a heart attack. CPK is an enzyme that catalyses the conversion of creatine to creatine phosphate, a high energy compound that works to supply energy during muscle contraction. Therefore this enzyme is present only in a few tissues like the cardiac muscle, skeletal muscle and the brain.

        CPK also exists in various isoenzyme forms. It has two polypeptides ‘B’ & ‘M’ that form dimers in the following combinations to give rise to three isoenzymes of CPK.

        MB — Predominant in cardiac muscle

        MM — Predominant in skeletal muscle

        Thus estimation of the isoenzyme MB is indicative of heart attack. CPK maintains a higher concentration in the plasma for 1-2 days. The concentration of CPK after the first attack is 10 times more than the normal and if another attack occurs within a day or two the concentration further increases to 100 fold and a third attack within a short span of time raises the level of CPK to 300 fold which is lethal concentration.

        Among the two transaminases, aspartyl transaminase (AST or SGOT) increases in the plasma following an attack and the higher levels are seen in 4 to 5 days following an attack.


        Z and S Mutations of the 㬑-Antitrypsin Gene and the Risk of Chronic Obstructive Pulmonary Disease

        Chronic obstructive pulmonary disease (COPD) has been associated with heterozygosity for the Z and S alleles of the α1-antitrypsin gene in some studies, but these observations have not been confirmed by others. Cigarette smoking is the major risk factor for COPD and may have been a confounding factor in many of the previous studies. We investigated whether the Z or S alleles were more prevalent in a group of heavy smokers with COPD than in a group of nonobstructed smokers. Forced expiratory volume in 1 s and forced vital capacity were derived for 266 patients undergoing lobar or lung resection. These lung-function measurements were used to divide the patients into a COPD group and a group of nonobstructed control subjects. The subjects were typed for the Z and S alleles of the α1-antitrypsin gene using a polymerase chain reaction–based technique. In the COPD patients, 12 of 193 (6%) were heterozygous for the Z allele (MZ) compared with 0 of 73 control subjects, which gave a PAG value of 0.04 after correction for age, gender, and smoking history. There was no association of the S allele with COPD. The results indicate that the Z, but not the S, allele is a risk factor for COPD in the heterozygous state.

        Chronic obstructive pulmonary disease (COPD) is characterized by decreased expiratory flow rates, increased pulmonary resistance, and hyperinflation. The processes that underlie these symptoms are thought to be proteolytic destruction of the lung parenchyma and inflammatory narrowing of the peripheral airways.

        The association between very low serum concentrations of α1-antitrypsin and pulmonary emphysema was originally described by Laurell and Eriksson (1). α1-Antitrypsin is a serine protease inhibitor (Pi) that primarily binds neutrophil elastase and therefore prevents the breakdown of elastic tissue, mainly in the lung. More than 70 different biochemical variants, or Pi types, have been described (2). The most common variant, M, consists of at least six subtypes, all characterized by normal serum α1-antitrypsin levels. The Z and S variants are associated with α1-antitrypsin deficiency. The population prevalences for the MM, MS, and MZ genotypes among whites are 86, 9, and 3%, respectively (3). MM individuals have normal levels of α1-antitrypsin, whereas MS and MZ individuals have mean levels of 75% and 57% of normal, respectively. Individuals with the ZZ genotype have severe α1-antitrypsin deficiency, with mean levels at ∼ 15% of normal, and are at increased risk for COPD (4). Homozygosity for the S allele results in a mean α1-antitrypsin level ∼ 52% of normal and occurs in ∼ 0.1% of whites (5, 6). Individuals with the SS genotype may have an increased risk for emphysema (7, 8). SZ compound heterozygotes are also at risk for COPD (9).

        The issue of whether the Z and S alleles are risk factors for COPD in the heterozygous state remains controversial. Several case–control studies have found a higher prevalence of MZ heterozygotes among COPD patients than in control populations (7, 8, 10-15). However, comparisons of MZ individuals with MM subjects from the general population have generally found no excess risk of COPD (or decline in respiratory function) associated with MZ heterozygosity (16-23).

        We have investigated the prevalence of α1-antitrypsin genotypes in a group of heavy cigarette smokers with and without airway obstruction. The subjects for both groups were selected on the basis of their development of bronchogenic cancer, which resulted in a study population with a high level of exposure to cigarette smoke. Therefore, the COPD patients could be compared with individuals who had maintained normal airway function despite being chronic heavy smokers. Measurements of lung elastic recoil (maximal static recoil pressure [P l max]) and emphysema were available for the majority of subjects. Therefore, we were able to investigate whether the Z allele was associated with emphysema and loss of elastic recoil, as suggested by previous studies (24). By employing a polymerase chain reaction (PCR) method to genotype the samples, we were able to include individuals in the study for whom only paraffin-embedded tissue samples were available.

        Subjects for the study were recruited from 532 patients undergoing lobar or lung resection. Before surgery, the patients completed an interviewer-administered questionnaire regarding smoking history, occupational exposure to dusts or fumes, and respiratory symptoms. Lung-function measurements made on each patient included subdivisions of lung volume measured in a pressure-compensated body plethysmograph, and maximal expiratory flow and volume. Values of forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), and the FEV1/FVC ratio were calculated. In 63% of the subjects a pressure volume curve of the lung was also obtained, from which the P l max was derived as previously described (25). In 68% of the subjects, resected lung samples were graded for emphysema as previously described (26).

        Any patients in whom the lung lesion was obstructing a segmental or larger bronchus, or in whom there was evidence of significant obstructive pneumonitis, were not included in the study because these conditions may influence lung function. There were 28 nonsmokers who were excluded from the study groups.

        On the basis of the lung function tests, the remaining 504 patients were divided into those with and without significant airway obstruction. Obstructed patients were those who had an FEV1 < 80% predicted and an FEV1/ FVC < 70%. Nonobstructed patients were those who had an FEV1 > 85% predicted and an FEV1/FVC > 75%. There were 219 patients classified as obstructed, and 73 as nonobstructed. All of the patients were of white ancestry. We were able to extract and amplify DNA successfully from 266 of these subjects, including 193 obstructed and 73 nonobstructed patients. In this population the mean age was 63 ± 10 yr, and mean cigarette smoking was 55 ± 33 pack-yr. The 212 subjects with intermediate levels of lung function were not used in the study.

        Genomic DNA was extracted from frozen lung-tissue samples, peripheral blood leukocytes (27), or paraffin-embedded tissue samples (28) by standard techniques.

        Detection of the Pi Z allele was performed by a modification of the PCR method described by Dry (29). For PCR amplification of the region of exon V containing the Z mutation, the following oligonucleotide primers were used: 5′TAAGGCTGTGCTGACCATCGTC3′ and 5′CAAAGGGTTTGTTGAACTTGACC3′.

        PCR was carried out in a 20-μl volume containing 100 ng genomic DNA 1 μM of each primer 200 μM each of dGTP, dCTP, dTTP, and dATP 1.5 mM MgCl2 and 0.5 U Taq DNA polymerase. Amplification conditions were 40 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 10 s. Samples were then digested at 65°C with 10 U of TaqI restriction enzyme, and electrophoresed on 3% agarose gels stained with ethidium bromide. The amplification produced a 110-base pair (bp) product and introduced a TaqI restriction site into the wild-type M allele but not into the Z allele. Therefore, after TaqI digestion, the M allele was cut into 89- and 21-bp bands, whereas the Z allele remained as a 110-bp band (Figure 1 ).

        Fig. 1. Analysis of the α1-antitrypsin Z and S mutations using restriction endonuclease digestion. (A) TaqI digestion of PCR products amplified from exon V yields an 89-bp fragment from the M allele and a 110-bp fragment from the Z allele. (B) TaqI digestion of PCR products amplified from exon III yields a 98-bp fragment from the M allele and a 78-bp fragment from the S allele. L = 100-bp DNA ladder.

        Analysis of the S allele in exon III was performed by a similar method. Primers were designed so that the upstream primer introduced an artificial TaqI restriction site in the M allele but not in the S allele. Primers for this analysis were 5′GAGGGGAAACTACAGCACCTCG3′ and 5′ACCCTCAGGTTGGGGAATCACC3′. The PCR was carried out using the same conditions as the Z mutation. The amplification produced a 98-bp product that was subsequently digested with 10 U of TaqI. The M allele sequence contained a TaqI restriction site and therefore was cut into 78- and 20-bp bands, but the S allele remained as a 98-bp band (Figure 1 ). Samples of these restriction enzyme analyses were confirmed using sequence-specific oligonucleotide (SSO) probes as described by Bruun-Petersen and colleagues (30).

        The associations of the Z and S mutations with obstruction were tested by the score test from logistic regression. Analyses were adjusted for the effects of age, sex, and smoking. Smoking was examined by cigarette years: the number of years smoked times the number of cigarettes smoked per day.

        The mean physiologic and morphologic data for the two groups are shown in Table 1. Because the obstructed and nonobstructed groups were significantly different for age, sex, and smoking, the results were corrected for these potentially confounding factors by logistic regression.

        Table 1. Population characteristics and pulmonary function values in obstructed versus nonobstructed individuals

        The prevalence of MS heterozygosity in all of the study subjects was 23 of 266 (9%). In addition, 2 of 266 (1%) subjects were found with the SS genotype. The distribution of genotypes was consistent with previous studies of white populations (3). The results are summarized according to phenotype in Table 2. The genotypes of all the MS and SS individuals were confirmed using the SSO method.

        Table 2. Prevalence of S and Z alleles of the α1-antitrypsin gene in obstructed and nonobstructed subjects

        * Adjusted for age, sex, and smoking history.

        In the obstructed group, 16 of 193 subjects (8%) were MS, compared with 7 of 73 (10%) in the nonobstructed subjects. The two SS homozygotes were from the obstructed group. The FEV1 values for these subjects were 71% and 70% predicted, and the FEV1/FVC values were 64% and 61%. The odds ratio associated with the MS/SS genotypes was 0.80 (95% CI = 0.29, 2.18) after correction for age, sex, and smoking history, and was not significant (PAG = 0.65).

        Twelve of 266 (4%) of the subjects in the study were heterozygous for the Z allele, and no ZZ individuals were detected. These data were consistent with previous population studies of white individuals (3). The prevalence of the MZ genotype in the obstructed and nonobstructed groups is summarized in Table 2. All of the MZ genotypes were confirmed by SSO typing.

        The Z allele was found in 12 of 193 (6%) of the obstructed group compared with 0 of 73 subjects in the nonobstructed control group. The MZ genotype was associated with airway obstruction after correction for age, sex, and smoking history (PAG = 0,04). It was not possible to calculate an odds ratio for this genotype because none of the control group had the mutation. There were no significant differences in mean P l max % predicted (89% versus 80%, PAG = 0.62) or mean emphysema score (14 versus 16, PAG = 0.77) in obstructed subjects with the MZ genotype versus obstructed patients with the MM genotype.

        Previous studies of α1-antitrypsin deficiency alleles and the risk of COPD have been of two designs. First, case– control studies were used to compare the prevalence of MZ and MS heterozygotes in groups of COPD patients and in control subjects. The usual finding from these studies was that the presence of the MZ genotype was a significant risk factor for COPD (7, 8, 10-15). The major criticism of these studies has been that the cases and controls were ascertained separately with different recruitment strategies. This may lead to a systematic difference between cases and controls (e.g., in ethnic background) that may bias the results.

        The second type of study designed to detect an effect of S and Z heterozygosity involved selecting samples of individuals with MZ or MS genotypes for comparison with MM individuals. For the most part these population studies have shown no increased risk of impaired lung function with heterozygosity for either allele (16-23). The major problem with these studies is that they have insufficient power to detect a factor that produces a modest increase in risk. In addition, many of the subjects in these studies were not old enough to have developed COPD or were nonsmokers. However, in some population studies MZ individuals were found to have significantly worse lung function (14, 31-35).

        In the present study we used a novel design to improve the power of the case–control approach and decrease the chance of ascertainment bias. By selecting only those individuals who have smoked enough to develop lung cancer we attempted to ensure that both the cases and the controls had a high exposure to the most important risk factor for airway obstruction. However, the obstructed group was older, had smoked more, and had a higher percentage of males than the nonobstructed group. These differences may have accounted for the development of COPD in the obstructed group. Therefore, we adjusted the results of the analyses by logistic regression.

        The genotype frequencies in our study subjects (9% MS, 4% MZ) were similar to those found in general white populations (9% MS, 3% MZ) (3). We did not identify any ZZ homozygotes in our study groups. Previous studies have found that 1 to 3% of COPD patients have the ZZ genotype (8, 11). We may have found fewer ZZ homozygotes than expected because our subjects were recruited from lung cancer patients. It is possible that ZZ individuals would have experienced fatal loss of lung function before they could have smoked enough to develop lung cancer. Alternatively, these individuals may have had early onset COPD with lung function sufficiently impaired to preclude lung resection.

        There was no association of the MZ genotype with emphysema or loss of elastic recoil. However, we cannot rule out such associations because the number of MZ subjects for whom these data were available was small (emphysema score, norte = 7 P l max, norte = 5). In addition, although patients who have COPD and are homozygous ZZ often have a pure form of emphysema, they may also present with primarily airway disease (36).

        Because all subjects were ascertained in the same way, the risk for a systematic bias in the genotype distribution was minimized. However, we recognize the possibility that an association observed in patients with lung cancer may not be applicable to the general population.

        We devised genotyping protocols that allowed detection of the Z and S alleles by PCR. The products of the amplification were designed to be short DNA fragments of approximately 100 bp. This enabled us to analyze DNA extracted from archival material in the form of blocks of paraffin-embedded tissue. DNA from such a source is frequently degraded, and it is often only possible to amplify small molecules. This approach permitted us to use the considerable patient resources available as pathologic specimens. By using a mismatched primer in the PCR reaction we were able to genotype the samples using TaqI restriction enzyme. This is a rapid, reliable, and inexpensive procedure that allowed efficient study of a large number of samples.

        The results demonstrated no difference in the prevalence of MS heterozygotes in the obstructed group compared with the nonobstructed. This result may reflect the fact that the S allele is a mild deficiency variant and if an increased risk of COPD is associated with the allele, it would be expected to be small. In some case–control studies an increased prevalence of MS genotypes in COPD patients has been reported (7, 8), whereas in others no association was found (12, 13, 15). Population studies have failed to detect increased risk of impaired lung function associated with the MS genotype (16, 18, 20-23). However, it is possible that the S allele may contribute to the susceptibility to COPD in conjunction with other factors (either genetic or environmental). The two individuals with the SS genotype had COPD, consistent with previous observations that this genotype is more prevalent in subjects with airway obstruction (7, 8).

        The Z allele causes a more severe deficiency of α1-antitrypsin, and the results of this study show that all of the MZ individuals in our population had COPD. This association was significant even after correction for potentially confounding factors such as age and smoking history. These results support previous studies that have suggested that the Z allele is a risk factor for COPD in the heterozygous state (7, 8, 10-15). The data indicate that intermediate deficiency of α1-antitrypsin enhances the decline in lung function that accompanies chronic exposure to cigarette smoke.

        In summary, we have used a novel study design to examine further the risk for COPD associated with S and Z heterozygosity. Although there was no increased risk for COPD associated with the presence of the S allele, we found that the prevalence of MZ individuals was increased in the COPD group compared with control subjects.


        Ver el vídeo: Θεραπευτική η φλούδα του καρπουζιού - Οι 5 ασθένειες που γιατρεύει (Mayo 2022).


Comentarios:

  1. Yoman

    También estoy emocionado con esta pregunta. Aviso, ¿dónde puedo encontrar más información sobre esta pregunta?

  2. Djoser

    Hay algo en esto. Muchas gracias por la información, ahora no cometeré semejante error.

  3. Radite

    Pido disculpas, pero, en mi opinión, este tema ya no es relevante.

  4. Tauramar

    Voluntariamente acepto. La pregunta es interesante, yo también participaré en la discusión. Sé que juntos podemos llegar a una respuesta correcta.

  5. Otik

    También dicen que el contacto abierto con los humanoides es posible en 2013.

  6. Wegland

    Gran idea y oportuno

  7. Burhleag

    una idea muy interesante



Escribe un mensaje