Información

8.12B: Deinococcus y Thermus - Biología

8.12B: Deinococcus y Thermus - Biología



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Objetivos de aprendizaje

  • Comparar las bacterias Deinococcus y Thermus

DEINOCOCCUS

Este es el único género de tres del grupo Deinococcales del filo Deinococcus-Thermus, y es altamente resistente a los peligros ambientales.. Tiene varias especies que son resistentes a la radiación (se han hecho famosas por su capacidad para comer desechos nucleares y otros materiales tóxicos), sobreviven en el vacío del espacio y en condiciones extremas de calor y frío. Hay 47 especies de Deinococcus descritas según NCBI el 25 de agosto de 2011.

Estas bacterias tienen paredes celulares gruesas que les dan tinciones grampositivas, pero incluyen una segunda membrana y, por lo tanto, tienen una estructura más cercana a la de las bacterias gramnegativas. Cavalier-Smith llama a este clado Hadobacterias (de Hades, el inframundo griego).

También se caracterizan por la presencia del pigmento carotenoide Deinoxantina que les da su color rosa, y una alta resistencia a las radiaciones gamma y UV. Por lo general, se aíslan de acuerdo con estos dos criterios.

D. RADIODURANOS

Deinococcus radiodurans es una bacteria extremófila, uno de los organismos más radiorresistentes conocidos. Puede sobrevivir al frío, la deshidratación, el vacío y el ácido, por lo que se le conoce como poliextremófilo y ha sido catalogada como la bacteria más resistente del mundo en El libro Guinness de los récords mundiales.

D. radiodurans es una bacteria esférica bastante grande, con un diámetro de 1,5 a 3,5 µm. Normalmente, cuatro células se unen formando una tétrada. Las bacterias se cultivan fácilmente y no parecen causar enfermedades. Las colonias son lisas, convexas y de color rosa a rojo. D. radiodurans no forma endosporas y no es móvil. Es un quimioorganoheterótrofo aeróbico obligado, es decir, utiliza oxígeno para derivar energía de compuestos orgánicos en su entorno.

A menudo se encuentra en hábitats ricos en materiales orgánicos, como suelo, heces, carne o aguas residuales, pero también se ha aislado de alimentos secos, polvo de habitaciones, instrumentos médicos y textiles. Es extremadamente resistente a la radiación ionizante, la luz ultravioleta, la desecación y los agentes oxidantes y electrofílicos. Su genoma está formado por dos cromosomas circulares, uno de 2,65 millones de pares de bases de largo y el otro de 412 mil pares de bases, así como un megaplasmido de 177 mil pares de bases y un plásmido de 46 mil pares de bases. Tiene alrededor de 3.195 genes. En su fase estacionaria, cada célula bacteriana contiene cuatro copias de este genoma; cuando se multiplica rápidamente, aumenta de ocho a 10 copias.

D. radiodurans es capaz de resistir una dosis aguda de cinco mil Gy (quinientos mil rad) de radiación ionizante casi sin pérdida de viabilidad, y una dosis aguda de 15 mil Gy con un 37% de viabilidad. Se estima que una dosis de cinco mil Gy introduce varios cientos de roturas de doble cadena (DSB) en el ADN del organismo (~ 0,005 DSB / Gy / Mbp (genoma haploide)). A modo de comparación, una radiografía de tórax o una misión Apolo implica alrededor de un mGy, cinco Gy pueden matar a un humano, dos a ochocientos Gy matan a E. coli y más de cuatro mil Gy matan al tardígrado resistente a la radiación.

Actualmente se conocen varias bacterias de radiorresistencia comparable, incluidas algunas especies del género Chroococcidiopsis (phylum cyanobacteria) y algunas especies de Rubrobacter (filo actinobacterias); entre las arqueas, la especie Thermococcus gammatolerans muestra una radiorresistencia comparable.

D. radiodurans también tiene una capacidad única para reparar el ADN dañado. Aísla los segmentos dañados en un área controlada y los repara. Esta bacteria también puede reparar muchos fragmentos pequeños de un cromosoma completo.

TERMO

Género de bacterias termófilas que pueden tolerar altas temperaturas, es una de varias bacterias pertenecientes al grupo Deinococcus-Thermus e incluye las siguientes tres especies: T. aquaticus, T. antranikianii, y T. igniterrae. Thermus aquaticus es la fuente de la enzima resistente al calor. ADN Taq polimerasa, una de las enzimas más importantes en biología molecular debido a su uso en la técnica de amplificación de ADN por reacción en cadena de la polimerasa (PCR).

Prospera a 70 ° C (160 ° F), pero puede sobrevivir a temperaturas de 50 ° C a 80 ° C (120 ° F a 175 ° F). Esta bacteria es un quimiotrofo: realiza la quimiosíntesis para obtener alimentos. Sin embargo, dado que su rango de temperatura se superpone un poco con el de las cianobacterias fotosintéticas que comparten su ambiente ideal, a veces se le encuentra viviendo en conjunto con sus vecinas, obteniendo energía para el crecimiento de su fotosíntesis.

Puntos clave

  • Los Deinococcales incluyen dos familias con tres géneros, Deinococcus y Truepera, el primero con varias especies resistentes a la radiación; son famosos por su capacidad para comer desechos nucleares y otros materiales tóxicos, sobrevivir en el vacío del espacio y en condiciones extremas de calor y frío.
  • los Thermales incluyen varios géneros resistentes al calor, incluyendo Thermus.
  • Estas bacterias tienen paredes celulares gruesas que les dan tinciones grampositivas, pero incluyen una segunda membrana y, por lo tanto, tienen una estructura más cercana a la de las bacterias gramnegativas.

Términos clave

  • radiorresistencia: Cualquier forma de resistencia que tenga un organismo para protegerse de los efectos nocivos de las radiaciones ionizantes.
  • clado: Grupo de animales u otros organismos derivados de una especie ancestral común.
  • poliextremófilo: Un organismo que puede tolerar dos o más factores ambientales extremos.

los Deinococcus-Thermus son un pequeño grupo de bacterias compuesto por cocos que son altamente resistentes a los peligros ambientales. Hay dos grupos principales: los Deinococcales incluyen dos familias, con tres géneros, Deinococcus y Truepera.

los Thermales incluyen varios géneros resistentes al calor (Marinithermus, Meiothermus, Oceanithermus, Thermus, Vulcanithermus).

Aunque estos dos grupos evolucionaron a partir de un ancestro común, los dos mecanismos de resistencia parecen ser en gran medida independientes.


Secuencia del genoma de alta calidad de la bacteria radiorresistente Deinococcus ficus KS 0460

Las plataformas genéticas de Deinococcus Las especies siguen siendo los únicos sistemas en los que se puede investigar in vivo el daño genómico masivo inducido por radiación ionizante (IR) a exposiciones acordes con la supervivencia celular. Presentamos la secuencia completa del genoma de la bacteria en forma de bastón extremadamente resistente a los rayos infrarrojos. Deinococcus ficus KS 0460 y su caracterización fenotípica. Deinococcus ficus KS 0460 se ha estudiado desde 1987, primero bajo el nombre Deinobacter grandis, luego Deinococcus grandis. los D. ficus El genoma de KS 0460 consta de una secuencia de 4.019 Mbp (69,7% de contenido de GC y 3894 genes predichos) dividida en seis particiones del genoma, cinco de las cuales se confirma que son circulares. La circularidad se determinó manualmente mediante el enlace de pares de parejas. Aproximadamente el 76% de las proteínas predichas contenían dominios Pfam identificables y el 72% se asignaron a los COG. De todo D. ficus Proteínas KS 0460, 79% y 70% tenían homólogos en Deinococcus radiodurans ATCC BAA-816 y Deinococcus geothermalis DSM 11300, respectivamente. Las diferencias más llamativas entre D. ficus KS 0460 y D. radiodurans Los BAA-816 identificados mediante la comparación de las vías de KEGG fueron los siguientes: (i) D. ficus carece de nueve enzimas de degradación de purina presentes en D. radioduransy (ii) D. ficus contiene ocho enzimas involucradas en el metabolismo del nitrógeno, incluidas las nitratos y las reductasas de nitrito, que D. radiodurans carece. Además, los genes que antes se consideraban importantes para la resistencia a los rayos infrarrojos faltan en D. ficus KS 0460, a saber, para el transportador de Mn nramp, y las proteínas DdrF, DdrJ y DdrK, todas las cuales también faltan en Deinococcus deserti. De lo contrario, D. ficus KS 0460 ejemplifica el Deinococcus linaje.

Palabras clave: Deinococcaceae Deinococcus ficus Deinococcus-Thermus Análisis del genoma Caracterización del fenotipo Análisis filogenético Resistente a la radiación En forma de varilla.

Declaracion de conflicto de interes

Conflicto de intereses

Los autores declaran no tener intereses en competencia.

Nota del editor

Springer Nature permanece neutral con respecto a los reclamos jurisdiccionales en mapas publicados y afiliaciones institucionales.


Contenido

Cuando comenzaron los estudios de las formas biológicas en las aguas termales de Yellowstone en la década de 1960, los científicos pensaron que la vida de las bacterias termófilas no podía sostenerse en temperaturas superiores a unos 55 grados Celsius (131 grados Fahrenheit). Pronto, sin embargo, se descubrió que muchas bacterias en diferentes manantiales no solo sobrevivieron sino que también prosperaron en temperaturas más altas. En 1969, Thomas Brock y Hudson Freeze de la Universidad de Indiana informaron sobre una nueva especie de bacteria termófila a la que llamaron Thermophilus aquaticus. [1] La bacteria se descubrió por primera vez en la región de la Gran Fuente del Parque Nacional Yellowstone y desde entonces se ha encontrado en hábitats termales similares en todo el mundo.


Resultados y discusión

Caracterización experimental de la resistencia a la radiación gamma y la desecación, y determinación de la relación Mn / Fe intracelular para T. thermophilus

Si bien los fenotipos de DR resistentes a la radiación y la desecación y los requisitos térmicos de TT y DR se han estudiado extensamente ([7, 12, 30] y las referencias allí), no conocemos ninguna caracterización detallada de la respuesta de TT a irradiación o desecación. Por lo tanto, buscamos investigar estas propiedades para obtener una imagen más completa de las diferencias en los fenotipos de respuesta al estrés de TT y DR. Como era de esperar, encontramos que TT era mucho más sensible a la irradiación aguda que DR. La curva de supervivencia de TT es similar a la de Esherichia coli K12. Para RD, la dosis de radiación que produce un 10% de supervivencia de la unidad formadora de colonias (UFC) (D10) es

16 kGy, mientras que para TT y E. coli, El d10 la dosis es

0,7 kGy, respectivamente (Figura 1). TT también es muy sensible a la desecación. La frecuencia de supervivencia a la desecación del 10% en CFU de la RD se mantiene después de 30 días, mientras que el TT alcanza el 10% de supervivencia a la desecación en CFU en

10 horas (0,4% de supervivencia después de 24 horas) y, para el quinto día, sufre esencialmente un 100% de letalidad. La baja resistencia de TT a la desecación se observa independientemente de la temperatura y la velocidad de secado (consulte el archivo adicional 1, "Desecación de TT a 65 ° C"). La resistencia a la desecación de E. coli resultó ser intermedio entre los de TT y DR (Figura 2).

Resistencia a la radiación de T. thermophilus (ATCC BAA-163), D. radiodurans (ATCC BAA-816) y E. coli (K-12 MG1655, proporcionado por M. Cashel, NIH) (irradiación con 60 Co). Se muestran las desviaciones estándar de los puntos de datos.

Resistencia a la desecación de T. thermophilus (ATCC BAA-163), D. radiodurans (ATCC BAA-816) y E. coli (K-12 MG1655) (temperatura ambiente). Tenga en cuenta que no se obtuvieron células supervivientes para las células desecadas a 65 ° C. Se muestran las desviaciones estándar para cinco puntos de datos.

Recientemente informamos de una tendencia de las proporciones de concentración intracelular de Mn / Fe en la resistencia bacteriana al IR, donde las proporciones muy altas y muy bajas de Mn / Fe se correlacionaron con resistencias muy altas y muy bajas, respectivamente [29]. También hemos demostrado que el crecimiento D. radiodurans en condiciones que limitaron la acumulación de Mn (II), redujeron significativamente la resistencia IR de las células [29]. Estas observaciones llevaron a la hipótesis de que la relación de Mn a Fe en una célula podría determinar la abundancia relativa de diferentes ROS inducidos durante la exposición y la recuperación de IR [28, 29]. A altas concentraciones, el Mn (II) puede actuar como un verdadero catalizador de la dismutación del superóxido (O2 • -), con el ciclo de Mn entre los estados divalente y trivalente, el ciclo redox de Mn elimina ambos O2 • - y peróxido de hidrógeno [31]. En este contexto, determinamos la relación Mn / Fe intracelular de TT utilizando un método de espectrometría de masas de plasma acoplado inductivamente (ICP-MS), como se describió anteriormente [29]. Las células TT contenían 0,211 (± 0,0254) nmol de Mn / mg de proteína y 4,54 (± 0,778) nmol de Fe / mg de proteína. La relación intracelular Mn / Fe de TT (D10,

0.8 kGy) es 0.047 comparado con 0.0072 para E. coli (D10,

0,7 kGy), 0,24 para D. radiodurans (D10,

16 kGy) y & lt0.0001 para Pseudomonas putida (D10,

0,25 kGy) [29]. Por lo tanto, TT parece ser algo más sensible a la IR aguda y la desecación de lo que predice su relación Mn / Fe, lo que sugiere la posibilidad de relaciones más complejas entre estas dos variables. En particular, la eliminación de O2 • - por Mn (II) depende en gran medida de la disponibilidad de H2O2, que en TT se esperaría que se volviera limitante durante la recuperación a 65 ° C debido a la descomposición térmica [32] El ciclo redox ineficaz de Mn puede conducir a la acumulación de Mn (III), que es citotóxico. Tanto DR como TT codifican un transportador de Mn de tipo ABC y un regulador transcripcional que probablemente regula la homeostasis del Mn. Además, DR tiene un transportador de Mn de la familia NRAMP, para el cual no hay ortólogo en TT.

Reconstrucción del árbol de contenido de genes y el repertorio de genes del ancestro común de Deinococcus y Thermus

La información sobre la presencia-ausencia de genes ortólogos en un conjunto de genomas puede utilizarse para producir un árbol de contenido genético [33, 34]. La topología de un árbol de contenido genético puede reflejar no solo las relaciones filogenéticas entre las especies comparadas, sino también las similitudes y diferencias en el estilo de vida [33, 35, 36]. Dadas las dramáticas diferencias en los estilos de vida y los fenotipos de resistencia de TT y DR, estábamos interesados ​​en determinar si el contenido genético de TT era más similar al de DR o al de otras bacterias termófilas o, quizás, incluso a arqueas. Con este fin, asignamos las proteínas codificadas en el genoma TT a los Clusters of Ortologous Groups of protein (COG) [37] y, utilizando los patrones de representación de las especies en los COG para calcular las distancias entre especies, reconstruimos un árbol de contenido genético. como se describió anteriormente [35]. En el árbol de contenido genético resultante, que incluía 62 genomas secuenciados de procariotas y eucariotas unicelulares, TT y DR se recuperaron con confianza como especies hermanas, y el linaje DR-TT se colocó dentro de un subárbol que también incluía Actinobacteria y Cyanobacteria, varias de las cuales son conocidos por sus resistencias extremas a la radiación y la desecación [38-40] (Figura 3). Para esta rama, la topología del árbol de contenido de genes imita las topologías de árboles construidos con otros enfoques basados ​​en datos de todo el genoma [34, 35], lo que indica que los repertorios de genes de estas bacterias, y TT y DR en particular, tienen estado divergiendo, aproximadamente, en forma de reloj. Para determinar qué genes probablemente se perdieron y ganaron en cada linaje, reconstruimos un escenario parsimonioso de evolución desde el último ancestro común bacteriano (LBCA) hasta TT y DR, hasta su último ancestro común. La reconstrucción se realizó sobre la base de la asignación de proteínas TT y DR a COG, junto con patrones filéticos basados ​​en COG de otros 62 genomas bacterianos y arqueales secuenciados [37], utilizando un método de parsimonia ponderada previamente desarrollado [41] (ver Métodos y archivo adicional 2). Este enfoque asigna 1310 genes (COG) al ancestro común DR-TT (Figura 4). De éstos, 1.081 (

80%) se retuvieron tanto en TT como en DR y pertenecen a su núcleo genético compartido. Dado que TT (2210 genes) tiene muchos menos genes codificadores de proteínas predichos que DR (3191 genes), parece probable que la divergencia de los dos implique una reducción sustancial del genoma en TT y / o expansión del genoma en DR. Sin embargo, los resultados de la reconstrucción sugieren que TT no ha experimentado una reducción masiva del genoma, aunque el flujo total de genes (es decir, la suma total de genes que se infiere que se han perdido y ganado) durante la evolución de este linaje fue considerable, lo que implica

25% del complemento genético. Por el contrario, DR ganó 272 COG, con solo 59 perdidos, lo que indica un crecimiento sustancial del genoma después de la divergencia DR-TT (Figura 4).

Árbol de contenido genético construido para 66 especies incluidas en la base de datos del COG sobre la base de los patrones de presencia-ausencia en los COG. los Thermus-Deinococcus El clado está marcado en negrita. Negro, bacterias amarillas, arqueas azules, eucariotas.

El escenario evolutivo reconstruido para el Thermus-Deinococcus clado. LBCA - Último antepasado común bacteriano DR-TT - el antepasado común de Thermus-Deinococcus clado TT - T. thermophilus DR- D. radiodurans. El número total de COG se muestra en cuadros para cada nodo. '+' indica ganancia de genes inferidos (COG) y '-' indica pérdida inferida.

También estábamos interesados ​​en determinar si existían similitudes entre los repertorios de genes de TT y dos hipertermófilos bacterianos profundamente ramificados, Aquifex aeolicus (AA) y Thermotoga maritima (TM). Encontramos que los genes que están presentes en TT pero no en DR tienen una probabilidad significativamente mayor de estar presentes en AA y TM que los genes presentes en DR pero no en TT (Tabla 1). Por el contrario, entre los 170 genes TT que se infiere que se han perdido, solo 20 estaban presentes tanto en AA como en TM. Por tanto, el repertorio de genes de TT tiene una similitud significativamente mayor con las bacterias hipertermófilas que el repertorio de genes de DR, tal vez como resultado de HGT directa o paralela (véase también más adelante).

La mayoría de los genes compartidos por TT y DR codifican proteínas domésticas y están muy extendidos en las bacterias. Entre ellos, 14 COG son inusuales porque no se encuentran en ninguna otra bacteria, sino que son compartidos por TT y DR con arqueas o eucariotas. Este conjunto incluye 8 subunidades de la H + -ATPasa de tipo Archaeal / vacuolar y otros seis COG que consisten en genes archaeal característicos (fosfoglicerato mutasa, COG3635 2-fosfoglicerato quinasa, COG2074 GTPasa similar a SAR1, COG1100 GTP: adenosilcobinail-fosfato-guasferasa66 Proteína de membrana prevista, COG3374 Metilasa de modificación del ADN prevista, COG1041).

Como se señaló anteriormente, algunos genes DR que pertenecen a familias bien representadas tanto en bacterias como en arqueas mostraron una clara afinidad por las arqueas [42]. Para evaluar cuántos genes de aparente ascendencia "termofílica" (ya sea arqueal o bacteriana) ya podrían haber estado presentes en el ancestro DR-TT común, realizamos un análisis filogenético de genes que fueron asignados al ancestro DR-TT y tenían 3 de los 5 mejores resultados para los genes de los termófilos (tanto arqueales como bacterianos, consulte el archivo adicional 1: "Análisis filogenético de los genes del ancestro común DR-TT reconstruido"). Encontramos que al menos 122 genes (

El 10% del repertorio de genes predicho del ancestro común DR-TT) de los 205 genes seleccionados originalmente mostró afinidad por especies termofílicas, es decir, una rama de dos genes ortólogos de DR y TT, o un gen DR o TT (en casos en los que el ortólogo respectivo aparentemente se perdió en el otro linaje) agrupados con termófilos (ver archivo adicional 1, tabla 1S y archivo adicional 6). Debido al hecho de que muchas topologías de árboles están muy perturbadas por múltiples eventos de HGT y pueden ser inexactas debido a las diferencias en las tasas evolutivas entre linajes, esta es solo una estimación aproximada del número de genes "termofílicos" en el ancestro DR-TT. En particular, no se puede descartar que algunos de los genes "termofílicos" ancestrales, que están actualmente presentes en TT pero no en DR (10 de estos genes de 122 genes probados), hayan sido adquiridos por TT a través de XGD (ver archivo adicional 1 , tabla 1S). En conjunto, estas observaciones sugieren la posibilidad de contactos ecológicos entre el ancestro DR-TT y arqueas hipertermófilas y / o bacterias, lo que lleva a una adquisición sustancial de genes "termófilos" a través de HGT.

Ganancia y pérdida de genes en Thermus

Nuestra reconstrucción de los eventos evolutivos que ocurrieron después de la divergencia de los linajes TT y DR del ancestro común delineó los conjuntos de genes que probablemente han sido ganados y perdidos por cada linaje (Figura 4). Primero consideramos con mayor detalle el patrón de pérdida y ganancia de genes en TT. La ausencia de ciertos genes metabólicos en el TT crea brechas en sus vías metabólicas, algunas de las cuales son esenciales. Sin embargo, TT es capaz de sintetizar todos los aminoácidos, nucleótidos y la mayoría de cofactores, lo que sugiere que los huecos se llenan con enzimas análogas o al menos no ortólogas. Se han descrito varios casos de este tipo. Por ejemplo, TT y DR codifican sintasas de timidilato no relacionadas, DR2630 (COG0207) y TTC0731 (COG1351). La timidilato sintasa clásica dependiente de folato (COG0207) presente en RD es probablemente ancestral en bacterias y aparentemente fue desplazada vía HGT en el Thermus linaje por la sintasa de timidilato dependiente de flavina, típica de arqueas y termófilos bacterianos. En otros casos, las enzimas o vías análogas sustituidas permanecen sin caracterizar. Por ejemplo, el desplazamiento de la timidilato sintasa dependiente de folato con el tipo dependiente de flavina en el linaje TT y en otras bacterias y arqueas se correlaciona con la pérdida aparente de dihidrofolato reductasa (folA, COG0262), que cataliza el último paso del tetrahidrofolato. vía de biosíntesis. Dado que el tetrahidrofolato es un cofactor esencial, lo más probable es que se produzca un desplazamiento. Recientemente, se ha demostrado que la proteína de fusión halobacteriana FolP-FolC complementa un Haloferax volcanii folA mutante [43]. Por tanto, parece probable que FolC y FolP en TT y otros organismos complementen la actividad de FolA, aunque no se puede descartar la existencia de una dihidrofolato reductasa no relacionada y aún no caracterizada.

Además, TT no codifica dos enzimas para la biosíntesis de fosfato de piridoxal (pdxK, COG0259 y pdxH, COG2240), mientras que DR tiene un conjunto completo de enzimas de esta vía. Nuestras reconstrucciones sugieren que pdxK probablemente se perdió en el linaje TT, mientras que DR probablemente adquirió de forma independiente pdxH. Sin embargo, es probable que la vía sea funcional en ambos organismos. Dado que se observan brechas similares en la biosíntesis de fosfato de piridoxal en una variedad de procariotas [44], parece que, al menos para algunos pasos de esta vía, existe un conjunto de enzimas distintas que permanecen sin identificar.

Algunos sistemas aparentemente se perdieron por completo en el linaje TT. Estos incluyen el complejo de ureasa, la vía de metabolismo de la ramnosa, acil CoA: acetato / 3-cetoácido CoA transferasa, transporte y utilización de fructosa y metabolismo de glicerol. En particular, la mayoría de estos sistemas también están ausentes en bacterias termófilas y muchas arqueas termófilas.

En contraste con DR, los genes que parecen haber sido adquiridos por TT muestran una clara conexión con el estilo de vida termofílico. En particular, TT parece haber adquirido 23 familias de genes del conjunto de determinantes termofílicos putativos [17], mientras que el ancestro DR-TT común tenía 5 genes de la lista, y DR parece haber adquirido solo uno (ver archivo adicional 3) . La mayoría de estas proteínas (17 de 31) están codificadas en el megaplasmido TT y 11 pertenecen al sistema de reparación de ADN móvil predicho característico de los termófilos [16, 45] (véase la Figura 7A a continuación). Además, TT ha adquirido 4 genes "arqueales" que no están codificados en ninguno de los genomas de bacterias mesófilas asignados a los COG (factor de liberación de cadena peptídica 1, metilasa de modificación del ADN COG1503, COG1041 y dos proteínas de membrana, COG3462 y COG4645).

UNA. Organización de genes que codifican el sistema de reparación de ADN putativo específico de termófilos en dos Thermus cepas y el borrador del genoma de D. geotermalis. Los cuadros en la parte superior de la figura muestran los números COG. Los genes se muestran mediante flechas de bloque que indican la dirección de la transcripción y se identifican por sus nombres sistemáticos. Para cada columna de la alineación, se indica el número COG correspondiente y la función predicha. D. geotermalis ' los genes están conectados con los respectivos ortólogos en ambas cepas TT mediante una línea recta. Generalmente, los genes ortólogos se muestran con el mismo color y patrón. Las excepciones son las proteínas RAMP de los COG 1336, 1367, 1604, 1337 y 1332, que se muestran todas en rosa. Otras RAMP más distantes también se muestran en rosa, con diferentes patrones [16]. Las proteínas que no pertenecen a los COG pero que tienen homólogos en otras especies están marcadas con diamantes. Abreviaturas: HEL, helicasa predicha, HD nucleasa - motivo conservado en HD que contiene la región conservada de nucleasa predicha POL - polimerasa predicha novedosa, RECB - nucleasa predicha de la familia RecB B. Comparación de la organización de genes en la región del megaplasmido que codifica la girasa inversa en dos cepas TT. El gen de girasa más corto en HB27 indica truncamiento. Abreviaturas: REVGYR, girasa inversa, MET_PR - proteasa dependiente de metales prevista REC_DNA - proteína de fusión de tres dominios (endonucleasa DnaQ, helicasa DinG y helicasa RecQ).

El sistema de oxidación de azufre tipo Sox se encuentra entre el grupo de genes que aparentemente fueron adquiridos en el linaje TT. El operón TT Sox es en parte similar al identificado en AA (ver archivo adicional 1, Figura 2S), y podría haber sido transferido horizontalmente entre los linajes AA y TT con posteriores reordenamientos locales. La presencia del operón Sox en TT sugiere que esta bacteria puede utilizar compuestos reducidos de azufre como fuente de energía y azufre. Otro sistema probablemente adquirido por TT es la utilización de lactosa (al menos tres proteínas: LacZ, COG3250 GalK, COG0153 GalT COG1085 GalA, COG3345). Este sistema también está presente en la MT, lo que indica que las bacterias termófilas pueden utilizar azúcares como fuentes de carbono.

Ganancia y pérdida de genes en Deinococcus

El linaje DR aparentemente ha adquirido muchos más genes de los que ha perdido (Figura 4). La mayoría de los genes perdidos por DR codifican enzimas del metabolismo energético y biosíntesis de cofactores. Un ejemplo es la pérdida de las tres subunidades del piruvato: ferredoxina oxidorreductasa, que es uno de los varios sistemas conocidos para la oxidación del piruvato, una reacción clave del metabolismo central. Otro ejemplo de pérdida de genes en RD involucra las tres subunidades de NAD / NADP transhidrogenasa, que es responsable de la reducción dependiente de energía de NADP + [46]. Además, el linaje DR perdió cuatro enzimas de biosíntesis de NAD y seis enzimas de biosíntesis de cobalamina, y consistentemente, DR depende de una fuente exógena de NAD para el crecimiento [28, 47].

Un número notable de genes aparentemente adquiridos por el linaje DR codifican sistemas de degradación de proteínas y catabolismo de aminoácidos (p.ej., ureasa, DRA0311-DRA0319, y un transportador de urea previsto, sistema de degradación de histidina DRA0320-DRA0324, monoaminooxidasa DRA0147-DRA0150, DRA0274 lisina 2,3-aminomutasa, DRA0027 quinureninasa y triptófano-2,3-dioxigenasa péptido DRA0339 E, DR1070 y carboxipeptidasa C, DR0964 y D-aminopeptidasa, DR1843 (consulte el archivo adicional 4). Se observa una tendencia similar para la expansión de varias familias de proteínas en RD, como las proteasas de tipo subtilisina secretadas (ver más abajo). Además, DR adquirió dos complejos de tres subunidades de monóxido de carbono deshidrogenasa de tipo aeróbico (DRA0231-DRA0233 y DRA0235-DRA0237). La oxidación del CO por esta enzima podría usarse como fuente de energía, como se muestra para algunas bacterias [48]. La adquisición y expansión de estos sistemas metabólicos, junto con la pérdida de ciertas capacidades biosintéticas, respalda la posibilidad de que la reestructuración metabólica pueda afectar la resistencia al estrés oxidativo en la RD al disminuir la necesidad de actividades celulares dependientes de alta energía. La producción de energía a través de la cadena respiratoria es una fuente importante de radicales libres en la célula [49].

La RD tiene muchos más genes para las proteínas involucradas en el transporte y el metabolismo de iones inorgánicos que la TT. En particular, DR ha adquirido el antiportador de múltiples subunidades Na + / H + (7 genes), ATPasa que transporta K + (3 genes) y el sistema de transporte FeoA / FeoB Fe. Esta abundancia de sistemas de transporte de iones podría estar indirectamente relacionada con la resistencia al estrés oxidativo a través de la regulación de los gradientes de iones de la membrana y la homeostasis de Mn / Fe (ver más arriba).

DR es más dependiente que TT de sustratos de crecimiento derivados de péptidos [47] y tiene un circuito de respuesta al estrés más complejo. De acuerdo con esto, los sistemas de transducción de señales de DR, según lo predicho por el análisis del genoma, son considerablemente más elaborados que los de TT. En particular, DR tiene al menos 33 COG (15 probablemente adquiridos después de la divergencia del ancestro común con TT) relacionados con funciones de transducción de señales que no están representadas en TT en comparación con 12 (5 adquiridos) de tales COG en TT. Además, aunque la mayoría de los dominios de transducción de señales son compartidos por DR y TT, las arquitecturas de dominio de las respectivas proteínas multidominio son completamente diferentes ([7] y KSM, observaciones no publicadas).

Entre los genes aparentemente adquiridos por DR, dos codifican proteínas multidominio que contienen distintos dominios sensores de unión a ligando periplásmico (DRA0202, COG5278 y DR1174, COG3614). Otra proteína, DRA0204, contiene el dominio CHASE3 [50] y está ubicada en un operón predicho con superóxido dismutasa (DRA0202), lo que indica una función en la respuesta al estrés oxidativo. La proteína DR0724 contiene el dominio SARP que participa en las vías de señalización relacionadas con la apoptosis en eucariotas [51], pero se desconoce su función en bacterias. Las funciones de las otras proteínas de transducción de señales de DR son incluso menos claras, con la notable excepción de una proteína similar a un fitocromo (DRA0050) que aparentemente fue adquirida por DR de una fuente bacteriana y ha sido implicada en la resistencia a los rayos UV [52].

Además, DR tiene muchos genes (25 COG) que codifican sistemas para la defensa microbiana. TT tiene solo 14 COG en esta categoría, 13 de los cuales se comparten con DR. El linaje DR adquirió específicamente al menos 7 genes para las subunidades del sistema de modificación de restricción, junto con varias enzimas resistentes a los antibióticos. Esta diferencia podría estar relacionada con las capacidades metabólicas reducidas de la RD, que depende de condiciones ricas en nutrientes para el crecimiento y, quizás, encuentra más especies microbianas que TT.

El análisis previo del genoma DR reveló 15 genes que parecen haber sido transferidos horizontalmente de fuentes inesperadas, como eucariotas y virus [7] sólo dos de estos 15 genes están presentes en TT, la proteína relacionada con la desecación de la familia de la ferritina y las proteínas de la familia de tipo Uma2 (véase la discusión de estas proteínas a continuación). Se ha demostrado que dos proteínas relacionadas con la desecación están implicadas en la desecación pero no en la resistencia a la radiación [53]. La ribonucleoproteína Ro aparentemente está implicada en la resistencia a los rayos UV [54], y la topoisomerasa IB, aunque activa, no tiene ningún papel conocido en la RD [55]. Hasta ahora, ninguno de estos genes se ha relacionado experimentalmente con la radiorresistencia en RD.

Identificación del desplazamiento de genes xenólogos mediante análisis filogenético

Está bien establecido que la HGT ha realizado importantes contribuciones al repertorio de genes de la mayoría de las bacterias termófilas, respaldado por la presencia de numerosos genes con una similitud inesperadamente alta y / o afinidad filogenética con genes típicos de las arqueas hipertermófilas [56-60]. Estos casos incluyen incluso aquellas proteínas que tienen ortólogos en bacterias mesófilas pero, como lo demuestra el análisis filogenético, tienen una clara afinidad por las arqueas o bacterias termófilas de linajes bacterianos distantes, lo que es indicativo de XGD [57]. Para investigar el impacto de HGT de termófilos que conducen a XGD en la evolución del repertorio de genes de TT, determinamos las afiliaciones taxonómicas de las proteínas del núcleo genético común de TT y DR. Utilizamos la distribución taxonómica de los mejores resultados en búsquedas BLAST para la identificación preliminar de candidatos a HGT, seguida de un análisis filogenético detallado de genes seleccionados.

Como era de esperar, en comparación con DR, TT tiene un exceso notable en la fracción de mejores aciertos para las bacterias termófilas y arqueas para las proteínas centrales y no centrales (Figura 5A y consulte el archivo adicional 5). Sin embargo, se ha informado de que el mejor resultado BLAST no siempre refleja con precisión la filogenia [61]. En particular, los artefactos del análisis del mejor resultado pueden ser causados ​​por sesgos similares en la composición de aminoácidos de las proteínas en TT y otros termófilos, como se demostró anteriormente [62, 63]. Para evaluar estos efectos de forma sistemática, realizamos un análisis filogenético de 112 proteínas TT y 21 proteínas DR del núcleo común que tuvieron sus respectivos mejores resultados en los termófilos (ver archivo adicional 7). A pesar de que todos estos árboles se construyeron para familias en las que las proteínas TT y DR no eran los mejores resultados mutuos en la base de datos de secuencias de proteínas no redundantes (Centro Nacional de Información Biotecnológica, NIH, Bethesda), más de la mitad de los árboles (69 árboles, 52%) recuperaron un clado DR-TT, 39 de estos agrupando este clado con mesófilos y 30 con termófilos (Figura 5B). Sin embargo, la diferencia de patrones evolutivos de DR y TT se encontró claramente en este análisis: se detectó una afinidad confiable con termófilos para 18 proteínas TT y solo una proteína DR. Es probable que los primeros casos representen a HGT en el linaje TT de otros termófilos, mientras que el único gen "termófilo" de DR puede implicar la dirección inversa de HGT, desde el linaje DR hasta Thermoanaerobacter tencongiensis (datos no mostrados).

Afinidades taxonómicas de las proteínas TT y DR. A. Distribución del número de mejores aciertos a proteínas de termófilos para proteínas centrales y no centrales de DR y TT. B. Distribución de las afinidades filogenéticas de las proteínas del núcleo DR-TT que han afectado mejor a las proteínas de los termófilos.

Se sabe que el sesgo de composición de aminoácidos afecta no solo a las búsquedas de similitud de secuencias, sino también a la reconstrucción de la filogenia [64]. Probamos este efecto en nuestro conjunto de datos comparando los árboles de máxima verosimilitud basados ​​en la secuencia con los árboles vecinos que se unen reconstruidos a partir de las frecuencias de aminoácidos de las proteínas correspondientes (consulte el archivo adicional 1, "Influencia de la composición de aminoácidos en las reconstrucciones filogenéticas"). Encontramos que, en la mayoría de los casos (& gt80%), la topología del árbol basado en secuencias no era congruente con la del árbol de composición de aminoácidos, por lo tanto, el efecto de la composición de aminoácidos en el desglose mostrado en la Figura 5B es es poco probable que sea sustancial. Tomados en conjunto, estos resultados sugieren que XGD que involucra genes de termófilos hizo una contribución medible a la evolución del conjunto de genes centrales de TT después de la divergencia del ancestro DR-TT común, no se detectó tal contribución en el caso de DR. Si bien esta interpretación parece más plausible dada la proximidad ecológica de TT y otros termófilos, no se puede descartar que los patrones observados (Figura 5B) se expliquen parcialmente por XGD con genes de bacterias mesófilas en el linaje DR. De manera más general, estos resultados enfatizan que la distribución taxonómica de los mejores resultados de la base de datos solo puede tomarse como un indicador preliminar y aproximado de HGT.

Entre los casos de XGD potencial respaldados por análisis filogenético, hay dos proteínas ribosomales, L30 y L15, que están codificadas por genes adyacentes dentro de un operón ribosómico conservado. Las proteínas codificadas por los genes circundantes en estos operones mostraron una clara afinidad por los correspondientes ortólogos de DR (datos no mostrados). En los árboles filogenéticos de L30 y L15, las proteínas TT se agruparon de manera confiable con ortólogos de hipertermófilos bacterianos y no con los correspondientes ortólogos DR (Figura 6A y 6B). Los patrones evolutivos congruentes observados con estas dos proteínas ribosómicas codificadas por genes adyacentes sugieren que este par de genes ha sido reemplazado a través de XGD. en el lugar, sin alteración de la organización del operón [65]. En la Figura 6C, D se muestran casos adicionales de XGD aparente, donde DR se divide con confianza en el clado mesófilo, mientras que TT pertenece al clado termófilo (en cada uno de estos casos, el clado termófilo tiene una mezcla de especies mesófilas mientras que el clado mesófilo no incluye termófilos).

Árboles filogenéticos para genes TT seleccionados con XGD aparente que involucran a un ortólogo de una especie termófila. Se construyeron árboles sin raíz de máxima verosimilitud y se calcularon las probabilidades de arranque utilizando el programa MOLPHY. Las ramas con probabilidad de arranque & gt70% están marcadas con círculos negros. Cada hoja está indicada por el identificador de genes estándar (para obtener la lista completa de correspondencia entre genes y especies, consulte el archivo adicional 1: "Identificadores de genes y nombres de especies para la figura 6"). Los genes DR y TT están encuadrados. Los genes de especies termofílicas se muestran en rojo. A. Proteína ribosómica L30. B. Proteína ribosómica L15. C. Proteína de biosíntesis de tiamina ThiC. D. Enzima de tiolación de ARNt TtcA.

La HGT específica de linaje aparente en DR y TT no se limitó a XGD ni a la adquisición de genes de termófilos. En la Tabla 2 se dan ejemplos adicionales de varios tipos de HGT respaldados por análisis filogenéticos.

Familias ampliadas de parálogos

La mayoría de los linajes bacterianos contienen conjuntos únicos de familias de genes parálogos expandidas [66]. Esta noción fue confirmada por el presente análisis genómico comparativo de DR y TT. Ninguna de las familias expandidas que se han detectado durante el análisis detallado previo del genoma DR [7] se expandió en TT, y muchas faltaban por completo.Esto sugiere fuertemente que la duplicación extensa de genes y la adquisición de nuevos pseudoparálogos a través de HGT, lo que llevó a la expansión de estas familias en RD, ocurrió después de la divergencia del ancestro común con TT, y podría contribuir a las adaptaciones específicas de RD (Tabla 3). . La expansión de varias otras familias en RD se reveló en el curso de la presente comparación con TT. Un ejemplo notable es la familia de proteínas asociadas a la membrana predichas (DR2080, DR1043, DR1952, DR1953, DR1738), que se codifican junto a reguladores transcripcionales de la familia tipo PadR (COG1695 9 parálogos en DR, ninguno en TT) (tabla 3). Los reguladores tipo PadR están implicados en la regulación de la respuesta celular a los agentes químicos de estrés, derivados del ácido fenólico [67]. Otra familia paráloga previamente desapercibida que se expande en DR incluye proteínas que contienen el dominio MOSC (MOCO sulfurasa C-terminal) (COG2258, cuatro parálogos en DR y uno en TT). Se ha predicho que estas proteínas funcionan como portadores de azufre que entregan azufre para la formación de grupos de azufre-metal asociados con varias enzimas [68]. Uno de estos genes (DR0273) forma un operón predicho con genes para una hidrolasa de Nudix y una monooxigenasa, lo que sugiere que estas proteínas podrían comprender un complejo distinto de respuesta al estrés / limpieza del hogar.

Varias familias parálogas se expanden específicamente en TT (Tabla 4). El más grande de estos (15 parálogos en comparación con tres en RD) es la familia Uma2 que está muy expandida en cianobacterias pero que, por lo demás, se observa en solo unas pocas bacterias. Se desconoce la función o funciones de estas proteínas; la presencia de residuos ácidos conservados sugiere que podrían ser proteínas de unión al ADN no caracterizadas [69]. La expansión de los transportadores de azúcar previstos en la TT y la escasez de proteasas extracelulares (incluidas las subtilasas) es inesperada porque se ha demostrado que la TT es predominantemente un organismo proteolítico más que sacarolítico [70]. Sin embargo, debe tenerse en cuenta que TT, a diferencia de DR, no se ha observado que secrete proteasas (datos no mostrados).

En particular, varias familias de proteínas que se expanden en TT pero están ausentes en DR pertenecen al conjunto de posibles determinantes termofílicos (fosfoesterasas predichas del dominio de unión a nucleótidos de HEPN relacionadas con la proteína Icc) [17] o se expanden en arqueas termofílicas (tipo PIN dominio nucleasa, nucleotidil transferasas mínimas, dominio de unión a nucleótidos similar a UspA [71], tabla 4). En particular, TT tiene tres parálogos del aldehído ferredoxin oxidorreductasa específico de arqueas que contiene tungsteno (TTC0012, TTC1834, TTP0122, TTP0212), que es la primera aparición de esta enzima en bacterias termófilas. Sin embargo, estas enzimas están presentes en varias bacterias mesófilas y tienen varias especificidades de sustrato y podrían estar involucradas en el metabolismo del azúcar, los aminoácidos o el azufre [72, 73].

Comparación de la reparación del ADN y los sistemas de respuesta al estrés.

El análisis comparativo de los sistemas genéticos bien caracterizados para la replicación, reparación y recombinación, y funciones relacionadas en TT y DR muestra que las fracciones de estos genes en los genomas respectivos son muy similares (Tabla 5, ver archivo adicional 1, Tabla 2S, 3S). Las mayores diferencias se observaron entre las proteínas asociadas con la reversión del daño directo (11 en TT frente a 26 en DR), lo que se debe a la extraordinaria expansión de la familia de hidrolasas NUDIX (MutT-like) en DR [7]. Cabe señalar que la mayoría de estas proteínas tienen otros sustratos además del 7,8-dihidro-8-oxoguanina-trifosfato (o difosfato), que es escindido por MutT. De manera consistente, la mayoría de las proteínas NUDIX parecen ser enzimas de "limpieza del hogar" en lugar de De buena fe componentes de sistemas de reparación [74]. Otras diferencias notables incluyen la aparente pérdida del represor transcripcional de respuesta SOS LexA [12] y otra proteína de respuesta SOS, la endonucleasa VII (XseAB) en el linaje TT, estas proteínas parecen haber sido perdidas también por otra bacteria termófila, AA. Por el contrario, DR tiene dos paralogs LexA (DRA0344 y DRA0074), pero sus funciones siguen sin estar claras. Una alteración genética de DRA0344, el parálogo que muestra una mayor similitud con la proteína LexA bacteriana canónica, no produce sensibilidad al daño del ADN o deterioro de la expresión de RecA [75]. La fotoliasa (PhrB) y la endonucleasa IV (nfo) se encuentran entre las pocas proteínas reparadoras del ADN que probablemente fueron adquiridas por TT después de la divergencia del ancestro común con DR. Además, la subunidad catalítica de la ADN polimerasa III de TT (DnaE, ​​TTC1806) tiene dos inteínas insertadas, mientras que la DR0507 ortóloga no tiene ninguna. En general, parece que los sistemas convencionales de reparación del ADN de TT y DR están estrechamente relacionados entre sí y con los respectivos sistemas de otras bacterias de vida libre. Por lo tanto, las características únicas y compartidas de estos sistemas no explican la gran diferencia observada en la resistencia entre las especies TT y DR.

Sin embargo, la conclusión de que no existen diferencias importantes entre los sistemas de reparación de TT y DR podría ser prematura. Recientemente, se han implicado varias proteínas adicionales de DR en la reparación del ADN o ARN, ya sea en experimentos directos o sobre la base de la regulación positiva después de la irradiación, complementada con el análisis de la secuencia de proteínas. Estas supuestas enzimas de reparación incluyen DRB0094, una ligasa de ARN [76] que está fuertemente regulada al alza en respuesta a la irradiación [27] y podría estar involucrada en un proceso de reparación de ARN no caracterizado, un complejo de reparación de rotura de doble hebra previsto específico para la recuperación después de la irradiación, que consta de DRB0100, una ADN ligasa, DRB0098, una proteína que contiene una fosfatasa de la familia HD y dominios de polinucleótido quinasa [7] DRB0099, una fosfatasa predicha de la superfamilia H2Macro ([27] y KSM, observaciones no publicadas) un ADN de doble cadena- proteína de unión PprA (DRA0346), que estimula la reacción de unión de extremos del ADN in vitro [77] una proteína de hibridación de cadena simple de ADN predicha DdrA (DR0423) [78] un regulador de la respuesta a la radiación IrrE (DR0167) una proteasa dependiente de metales fusionada a un dominio hélice-vuelta-hélice [79, 80] y la proteína no caracterizada DR0070 que ha demostrado ser esencial para una resistencia total a la irradiación aguda [27]. Entre estas proteínas de reparación de DR mal caracterizadas (predichas), solo DdrA tiene un ortólogo en el genoma TT. En general, estos genes de reparación putativos están escasamente representados en bacterias, y parece muy poco probable que estuvieran presentes en el ancestro común de TT y DR. Lo más probable es que estos genes fueron adquiridos por el linaje DR a través de HGT después de la divergencia del ancestro común. con TT, y podría haber contribuido a la evolución del fenotipo de resistencia. Sin embargo, la relevancia funcional de estos genes para la resistencia a la radiación aún no se ha confirmado porque la mayoría de los mutantes knockout correspondientes mostraron sólo disminuciones relativamente pequeñas a moderadas en la resistencia a la radiación [27, 78].

Entre las enzimas reparadoras únicas (predichas) de TT, las más conspicuas son los componentes del sistema de reparación putativo específico de termófilos, que están codificados predominantemente en el megaplasmido TT (Figura 7A). Las características funcionales de las proteínas codificadas en este sistema (COG1203, una helicasa de ADN, a menudo fusionada con una hidrolasa de la superfamilia HD predicha COG1468, una exonucleasa COG1353 de la familia RecB, polimerasa predicha) sugieren que están involucradas en una reparación del ADN aún no caracterizada. ruta. Se ha planteado la hipótesis de que este nuevo complejo de genes podría ser funcionalmente análogo al sistema bacteriano-eucariota de translesión, reparación mutagénica cuyos componentes centrales son las ADN polimerasas de la superfamilia UmuC-DinB-Rad30-Rev1, que normalmente faltan en los termófilos [16]. .

La comparación de proteínas que comprenden varios sistemas (previstos) involucrados en la respuesta al estrés revela un mayor número y diversidad de dichas proteínas en RD, que tiene 26 COG con funciones relevantes que no están representadas en TT en comparación con 3 de tales COG en TT (ver archivo adicional 1 , Tabla 4S). En total, hay 147 proteínas en RD en esta categoría y 86 en TT, lo que sugiere que algunas de ellas se expanden adicionalmente en RD (ver la sección sobre "Familias expandidas").

Los sistemas enzimáticos de defensa contra el estrés oxidativo predichos en TT y DR también muestran diferencias importantes. TT tiene una superóxido dismutasa dependiente de Mn (SodA) [81] y una catalasa dependiente de Mn (sin ortólogo en RD), mientras que DR codifica tres superóxido dismutasa (una de las cuales es el ortólogo del gen SodA de TT) y tres catalasas pronosticadas sin ortólogos TT [7]. Además, la DR tiene una peroxidasa de citocromo C (DRA0301) y una peroxidasa dependiente de hierro predicha (DRA0145), enzimas que probablemente brinden protección contra peróxidos tóxicos [49]. Los ortólogos de estas enzimas son raros entre las bacterias, lo que sugiere que la Deinococcus el linaje los adquirió a través de HGT después de la divergencia de TT y DR del ancestro común. La reducción de los residuos de metionina oxidada en las proteínas es crucial para la supervivencia de las células sometidas a estrés oxidativo [82, 83]. De acuerdo con esta idea, dos péptidos metionina sulfóxido reductasas (PMSR), MsrA (DR1849) y MsrB (DR1378), están codificados en el genoma DR [84, 85], mientras que ninguno está presente en TT. Curiosamente, ambos PMSR también faltan en Aquifex, Thermotoga y la mayoría de las arqueas termófilas, lo que sugiere al menos dos posibilidades: o este tipo de daño oxidativo es raro a altas temperaturas o los PMSR conocidos son reemplazados por enzimas análogas no caracterizadas debido a la ineficacia del primero a altas temperaturas.

Los mecanismos de defensa del estrés oxidativo también podrían incluir el control de la partición de Mn y Fe en la célula [29]. Las proteínas de la familia Dps / ferritina son necesarias para el almacenamiento de hierro en un estado no reactivo, lo que evita la formación catalizada por hierro de radicales hidroxilo, protegiendo así a la célula de la toxicidad por hierro (química de tipo Fenton) [86]. Dos proteínas relacionadas con Dps están codificadas en el genoma DR (DR2263, DRB0092, COG1528), y se ha demostrado que una de ellas (DR2263) protege el ADN tanto de la escisión de radicales hidroxilo como de la escisión mediada por DNasa I [87]. Algunas proteínas homólogas a DPS pueden unirse al ADN de forma no específica y, por lo tanto, se consideran protectores específicos del ADN [88]. Como la mayoría de los termófilos, TT no tiene proteínas de esta familia, pero codifica una ferritina de otra familia (TTC1122).

Dado que la desecación también causa estrés oxidativo, las proteínas implicadas en la resistencia a la desecación pertenecen a la categoría de defensa celular general [89]. En DR [7] se han detectado proteínas relacionadas con la desecación de al menos dos familias distintas. Estas familias de proteínas de resistencia a la desecación (familia Lea 76, DR0105 y DR1172 y familia Lea14, DR1372) no están representadas en TT. Sin embargo, tres proteínas TT (TTP0170, TTP0166, TTP0169) son homólogas de otra proteína de resistencia a la desecación que se caracterizó originalmente en una planta, Craterostigma plantagineum [90] DR también tiene dos proteínas de esta familia, DRB0118 y DRA0258. Estas proteínas están relacionadas lejanamente con COG1633 y pertenecen a la familia ferritina de proteínas de almacenamiento de hierro (KSM, no publicado). Los homólogos altamente conservados de estas proteínas también están presentes en bacterias termófilas y arqueas. Dos proteínas relacionadas con la desecación (DR1172 y DRB0118) parecen ser esenciales para la resistencia a la desecación, pero no para la resistencia a la radiación en la RD [53].

Comparación de las particiones del genoma de TT y DR

Tanto TT como DR tienen genomas multipartitos. Para examinar las posibles relaciones evolutivas entre las particiones del genoma de TT y DR, analizamos la distribución de los mejores aciertos simétricos (ortólogos putativos) en el único elemento extracromosómico de TT, el megaplasmido pTT27 y las tres particiones más pequeñas del genoma de DR (pequeñas cromosoma, megaplasmido DR412, DR177 y plásmido, CP1 Tabla 6). Los resultados de este análisis muestran que pTT27 tiene un exceso muy significativo de ortólogos en DR177, lo que sugiere que estos dos megaplasmidos son homólogos, es decir., probablemente evolucionó a partir de una partición genómica distinta del ancestro DR-TT común. Aparentemente, sin embargo, los genomas de los megaplasmidos han sufrido extensos reordenamientos desde la divergencia del ancestro común porque no se pudo identificar la conservación del orden de los genes (datos no mostrados).

En particular, entre los supuestos determinantes termofílicos de TT,

El 50% está codificado en el megaplasmido (18 de 36). De estos, 11 pertenecen al sistema de reparación de ADN específico de termófilos móviles putativo [16, 45] (Figura 7A). Además, el megaplasmido lleva al menos otros cuatro genes asociados con este sistema, que aún no se han asignado a los COG (Figura 7A). Además, el megaplasmido TT también lleva un pseudogen para la girasa inversa, la proteína de firma más conspicua de los hipertermófilos [15, 17].

Recientemente, el genoma de otra cepa de TT (HB8) se ha secuenciado completamente y está disponible en bases de datos públicas [13]. Una comparación preliminar de las dos cepas TT (HB27 y HB8) reveló diferencias considerables en el orden de los genes y el contenido de los megaplasmidos (consulte el archivo adicional 1, Figura 3S). Curiosamente, estas diferencias en el contenido de genes se derivan principalmente de genes que parecen estar asociados con el estilo de vida termofílico. En particular, la cepa HB8 codifica una girasa inversa intacta. Por tanto, parece más probable que el gen de la girasa inversa fuera adquirido de una fuente hipertermofílica por el linaje TT y estuviera presente en el antepasado común de HB27 y HB8, pero decayó en el primero. Por el contrario, HB27 codifica una proteína de fusión de tres dominios única (endonucleasa DnaQ, helicasa DinG y helicasa RecQ), mientras que HB8 carece de los ortólogos DinG y RecQ (Figura 7B). Además, existen diferencias inesperadas en la organización de los sistemas de reparación específicos de termófilos predichos entre las dos cepas de TT. Específicamente, HB27 contiene una "versión grampositiva" (TTP0132-TTP0136), mientras que HB8 tiene una "versión proteobacteriana" de estos genes (TTHB186-TTHB194) (Figura 7A).

Además, un borrador de la secuencia del genoma casi completo de Deinococcus geothermalis (DG) se ha hecho pública recientemente [91]. Dado que DG está estrechamente relacionado con DR pero es moderadamente termófilo, buscamos genes "termófilos" en el genoma de DG. Usando las secuencias de proteínas "termofílicas" ([17] y ver arriba) de TT y DR como consultas, identificamos ortólogos de 5 de las 6 proteínas DR de este conjunto (cuatro de estas también están presentes en ambas cepas TT) y ortólogos de 7 de las 23 proteínas "termofílicas" restantes de TT (todos los componentes del sistema de reparación del ADN termofílico predicho). Estas 7 proteínas tenían las respectivas proteínas TT como los mejores resultados, y su monofilia fue respaldada por análisis filogenéticos (datos no mostrados), lo que sugiere que estos genes ya estaban presentes en el genoma del ancestro común DR-TT.

Estas observaciones dan lugar a dos hipótesis: (i) el megaplasmido TT es fundamental para la supervivencia del organismo a altas temperaturas. De acuerdo con esta idea, detectamos una expansión de un sistema toxina-antitoxina de dos componentes, que consta de una nucleasa similar a PIN (toxina) y un regulador transcripcional de la familia MazE (antitoxina) [69]. Se sabe que un sistema de este tipo es responsable de la estabilidad de segregación de los plásmidos resistentes a los antibióticos y otros plásmidos mediante la eliminación selectiva de las células que no han logrado adquirir una copia del plásmido [92] y / o la exclusión de plásmidos competidores [93] y (ii) el megaplasmido TT es un compartimento genómico dinámico y un verdadero sumidero de genes transferidos horizontalmente, algunos de los cuales podrían afectar el fenotipo termofílico de esta bacteria. Esto es compatible con las considerables diferencias en el contenido de genes observadas entre las dos cepas TT.

Las funciones específicas de los genes transmitidos por plásmidos en la recuperación del daño del ADN se han propuesto anteriormente, incluida la ribonucleótido reductasa de clase Ib, la fosfatasa alcalina periplásmica y la nucleasa extracelular, y los análisis posteriores revelaron al menos otros cinco genes implicados en este proceso (dos operones, DRB0098- DRB0100, DRB0094-DRB0084, ver arriba en "Comparación de la reparación del ADN y los sistemas de respuesta al estrés") [27, 76]. También hay un operón del sistema toxina-antitoxina en el megaplasmido DR177 (DRB0012a y otro gen ubicado inmediatamente aguas arriba de DRB0012a y actualmente ausente de la anotación del genoma). Además, hay otros cinco sistemas de toxina-antitoxina codificados en DR412, el cromosoma más pequeño de DR, que podría estar relacionado con el mantenimiento del megaplasmido DR177 en DR. El cromosoma DR412 también parece tener algunas características especiales. Numerosos genes que aparentemente han sido adquiridos por DR a través de HGT después de la divergencia del ancestro común con TT y están implicados en varios procesos de degradación de aminoácidos y nucleótidos, mapean esta partición del genoma. Así, los megaplasmidos de TT y DR (y el cromosoma más pequeño de DR, DR412) parecen haber participado en una HGT extensa, lo que podría haber sido importante para la evolución de la termofilia y la radiorresistencia, aunque los repertorios de los respectivos genes adquiridos son completamente diferentes. .


Fisiología y biología

Deinococcus son resistentes a entornos hostiles

Deinococcus radiodurans exhibe una resistencia incomparable al estrés oxidativo (Slade y Radman 2011 Misra et al. 2013). El estrés oxidativo puede ser causado por especies reactivas de oxígeno producidas por la respiración, exposición a irradiación o agentes químicos. Deinococcus radiodurans puede sobrevivir a altas dosis de radiación ionizante (hasta 2000 rupturas de doble cadena por bacteria) sin daño considerable irreversible del ADN o de las proteínas, y puede reensamblar su cromosoma con alta fidelidad. La resistencia de esta bacteria a estos estreses se debe a múltiples mecanismos convergentes.

Dos vías diferentes para la asimilación de glucosa, la pentosa fosfato y la glucólisis, están presentes y activas en Deinococcus. Liedert et al. (2012) propuso que D. geotermalis crece en condiciones aeróbicas al canalizar preferentemente la glucosa a la vía de la pentosa fosfato, generalmente involucrada en la regeneración de NADPH en lugar de NADH, de acuerdo con nuestras observaciones sobre el crecimiento exponencial D. geotermalis (Leonetti, J.-P., resultados no publicados). La vía de las pentosas fosfato y el NADPH generado están directamente involucrados en los mecanismos de reparación y resistencia al estrés oxidativo (Juhnke et al. 1996 Rui et al. 2010). La subutilización de la glucólisis puede ser un medio para limitar la formación de NADH y evitar la generación de especies reactivas de oxígeno durante su reciclaje por la cadena respiratoria. Este rasgo es un corolar de la resistencia de Deinococcus a la irradiación y es de gran importancia para la biotecnología, ya que el NADPH es utilizado por varias vías anabólicas, como la síntesis de aminoácidos (por ejemplo, arginina, prolina, isoleucina, metionina y lisina), síntesis de vitaminas (por ejemplo, pantotenato, filoquinona y tocoferol), síntesis de poliol (por ejemplo, xilitol), síntesis de isoprenoides y síntesis de ácidos grasos. Además, el NADPH es la fuente de equivalentes reductores de la hidroxilación del citocromo P450 de compuestos aromáticos, esteroides, alcoholes y fármacos. Los microorganismos más utilizados en bioproducción, como E. coli y S. cerevisiae, producen principalmente NADH y Deinococcus podría usarse como un anfitrión preferencial para construir rutas que consuman NADPH. Sin embargo, modelos metabólicos confiables de Deinococcus todavía faltan en la literatura, lo que hace que la ingeniería metabólica requiera más tiempo y trabajo, como ocurre con la mayoría de los nuevos chasis alternativos. es más Deinococcus nunca ha sido fermentado a una escala compatible con una aplicación industrial.

A pesar de que Deinococcus es una bacteria no esporulante, es extremadamente resistente a la desecación. Mattimore y Battista (Mattimore y Battista 1996) han demostrado que D. radiodurans R1 puede sobrevivir 6 semanas de desecación, mientras que la viabilidad de E. coli se redujo en seis logaritmos después de solo 7 días. Se cree que la resistencia a la radiación ionizante y la desecación son procesos evolutivos estrechamente vinculados porque la resistencia a la desecación parece requerir una reparación extensa del ADN (Mattimore y Battista 1996). Deinococcus posee una vía para la síntesis de trehalosa a partir de maltooligosacáridos (Timmins et al. 2005) y puede producir trehalosa (resultados no publicados), un osmolito común. El papel protector de este osmolito en el estrés osmótico, el choque térmico y la deshidratación ha sido bien caracterizado en otras especies (Purvis et al. 2005 Yu et al. 2012). Sobrevivir a la desecación es un problema importante para la producción de cultivos iniciadores para aplicaciones industriales (Hofman y Thonart 2010).

La capacidad de las células para tolerar el estrés a menudo es limitante en entornos industriales y es multifactorial. Wang y et al. (Wang et al. 2012, 2013) encontró que el regulador de transcripción IrrE de D. radiodurans, cuando se transforma en E. coli, mejoró la tolerancia al etanol, butanol y acetato (de 10 a 100 veces), y confirió una tolerancia cruzada significativa a otros dos inhibidores comunes que se encuentran en los hidrolizados lignocelulósicos, el 5-hidroximetil-2-furaldehído y la vainillina. los IrrE gen codifica un factor de transcripción de cambio general que es responsable de la radiorresistencia extrema de D. radiodurans (Conde et al. 2002 ).

Deinococcus tiene una envoltura celular gruesa inusual

Deinococcus a menudo forma tétradas (Fig. 2a, c). La mayoría de las bacterias se pueden clasificar fácilmente como Gram positivas o Gram negativas debido a la presencia o ausencia, respectivamente, de una pared celular gruesa (Fig. 2d) de peptidoglicano que secuestra la tinción después del tratamiento. La envoltura celular de Deinococcus difiere según la especie y presenta una estructura y composición inusuales. Deinococcus indicus, D. grandis y D. deserti cepa YIM 007 T tinción Gram-negativa, mientras que la mayoría de las otras Deinococcus tinción de especies Gram-positivas. La coloración Gram-positiva de muchos Deinococcus recuerda a las gruesas capas de peptidoglicano de las bacterias gramnegativas que son difíciles de decolorar.

Según lo revisado por otros (Makarova et al. 2001), las siguientes seis capas de la envoltura celular se han identificado mediante microscopía electrónica: (i) la capa más interna es la membrana plasmática común a todas las células y está compuesta de lípidos inusuales, incluidas las cadenas de alquilamina. (ii) le sigue una pared celular de peptidoglicano perforada. (iii) la tercera capa es única y puede estar compuesta por una matriz de pequeños compartimentos no caracterizados. (iv) la cuarta capa es otra membrana plasmática y es la membrana externa. (v) la quinta capa es una zona electrolúcida distinta. (vi) la sexta capa consta de subunidades de proteínas hexagonales empaquetadas regularmente (la capa S, o capa intermedia empaquetada hexagonalmente), típica de otras capas S bacterianas. Varias cepas de Deinococcus están rodeados por una densa capa de carbohidratos.

Se desconoce si esta gruesa estructura inusual está directamente involucrada en la resistencia a los xenobióticos, pero D. geotermalis Se ha informado que la cepa T27 sobrevive en presencia de altas concentraciones de acetato de etilo, tolueno y ftalato de dietilo proporcionados como una capa no acuosa a una suspensión celular (Kongpol et al. 2008 ).

Deinococcus forma biopelículas

Deinococcus geothermalis forma biopelículas (Fig. 2b). Esta especie se encuentra con frecuencia en las máquinas de papel (Väisänen et al. 1998 Kolari et al. 2001), y es muy difícil de quitar de las superficies de acero. Deinococcus geothermalis Se informó que E50051 persistía después de 1 h de lavado con 0,2% de NaOH o 0,5% de dodecilsulfato de sodio, en contraste con otros formadores de biopelículas, como Burkholderia cepacia F28L1, Staphylococcus epidermidis O-47 y D. radiodurans cepa DSM 20539. La unión de D. geotermalis implica estructuras en forma de hilo que interactúan con la superficie de la maquinaria (Saarimaa et al. 2006). La adhesión mediada por pili es común a múltiples bacterias patógenas Gram negativas y Gram positivas. Saarimaa et al. caracterizó la adherencia de los hilos de D. geotermalis como pili glicosilados de tipo IV que están estrechamente relacionados con el sistema de secreción de proteínas de tipo II (Sandkvist 2001 Peabody et al. 2003). Genes de pili de tipo IV homólogos a putativos pil genes en D. radiodurans también han sido implicados en la competencia natural de T. thermophilus HB27, un pariente cercano de Deinococcus, y en la secreción de diversas enzimas extracelulares (Friedrich et al. 2002 ).

Las biopelículas bacterianas pueden dañar o mejorar los procesos industriales. Muy a menudo, las biopelículas se consideran un defecto porque pueden obstruir los tubos y afectar los procesos de fermentación. Sin embargo, la formación de biopelículas puede ser ventajosa, ya que se puede utilizar para aumentar la densidad de biomasa en un reactor porque no depende del reciclaje celular, no hay necesidad de volver a inocular en la fermentación de lotes repetidos y puede evitar el lavado. 'cuando se utilizan procesos continuos con una alta tasa de dilución. Además, las biopelículas suelen ser más resistentes a condiciones extremas. La formación de biopelículas no es inherente a la Deinococcus familia o incluso a D. geotermalis.


Acceso al documento

  • APA
  • Autor
  • BIBTEX
  • Harvard
  • Estándar
  • RIS
  • Vancouver

En: Anuncios del genoma, vol. 3, N ° 2, e00202-15, 2016.

Resultado de la investigación: Contribución a la revista ›Artículo› revisión por pares

T1 - Borrador de la secuencia del genoma de la cepa A de la bacteria Deinococcus-Thermus Meiothermus ruber

N1 - Copyright del editor: 2015 Thiel et al. Copyright: Copyright 2018 Elsevier B.V., Todos los derechos reservados.

N2 - El borrador de la secuencia del genoma de la cepa A de la bacteria Meiothermus ruber del grupo Deinococcus-Thermus, aislada de un cultivo de enriquecimiento de cianobacterias obtenido de Octopus Spring (Parque Nacional Yellowstone, WY), comprende 2,968,099 bp en 170 contigs. Se prevé que contenga 2.895 genes que codifican proteínas, 44 genes que codifican ARNt y 2 operones de ARNr.

AB - El borrador de la secuencia del genoma de la cepa A de la bacteria Meiothermus ruber del grupo Deinococcus-Thermus, aislada de un cultivo de enriquecimiento de cianobacterias obtenido de Octopus Spring (Parque Nacional Yellowstone, WY), comprende 2,968,099 pb en 170 contigs. Se prevé que contenga 2.895 genes que codifican proteínas, 44 genes que codifican ARNt y 2 operones de ARNr.


Distribución de ATPasas de tipo F y A / V en Thermus scotoductus y otras especies estrechamente relacionadas

La presencia de una ATPasa de tipo A / V en diferentes especies de Thermus y en las especies de ramificación más profunda Meiothermus ruber y Deinococcus radiodurans sugiere que la presencia de la ATPasa de tipo arquea es un carácter primitivo de los Deinococci que se adquirió a través de la transferencia horizontal de genes ( HGT). Sin embargo, se informó la presencia de F-ATPasas de tipo bacteriano en dos especies de Thermus recientemente identificadas (Thermus scotoductus DSM 8553 y Thermus filiformis DSM 4687). Dos escenarios diferentes pueden explicar este hallazgo, ya sea el reemplazo reciente de la ATPasa de tipo A / V ancestral en Thermus scotoductus y Thermus filiformis con una ATPasa de tipo F recién adquirida o una persistencia a largo plazo de ATPasa de tipo F y A en el Deinococci, lo que implicaría varias pérdidas independientes de la ATPasa de tipo F en los Deinococci. Utilizando PCR con cebadores redundantes, secuenciación y análisis de transferencia Southern, intentamos confirmar la presencia de una ATPasa de tipo F en el genoma de Thermus scotoductus y Thermus filiformis, y determinar sus afinidades filogenéticas. Los experimentos iniciales parecieron confirmar la presencia de una ATPasa de tipo F en Thermus scotoductus que era similar a las F-ATPasas encontradas en Bacillus. Sin embargo, otros experimentos revelaron que la detección de una F-ATPasa se debió a la contaminación de un cultivo. Para todas las especies de Thermus y Deinococcus estudiadas, incluido Thermus scotoductus, los cultivos que estaban libres de contaminación solo contenían ATP sintasas de tipo A / V.


8.12B: Deinococcus y Thermus - Biología

Ther.ma.ce'ae. N.L. masc. norte. Thermus, género tipo de la familia L. suf. -aceae, terminando para denotar una familia N.L. fem. pl. norte. Thermaceae, los Thermus familia.

“Deinococcus – Thermus” / Deinococci / Thermales / Thermaceae

Las células son varillas rectas de filamentos de longitud variable que también están presentes. No hay flagelos inmóviles. Tinción Gram-negativa. No se observan endosporas. La mayoría de las cepas forman colonias pigmentadas de color amarillo o rojo, pero algunas cepas no están pigmentadas. Termófilo o ligeramente termófilo, con un rango de temperatura de crecimiento óptimo de aproximadamente 45 a 75 ° C. Algunas cepas son ligeramente halófilas. Quimioorganotróficas algunas cepas son quimioorganótrofos facultativos que oxidan compuestos de azufre e hidrógeno molecular. Aerobio o anaeróbico facultativo con un tipo de metabolismo estrictamente respiratorio. Algunas cepas son microaerófilas varias cepas crecen anaeróbicamente con nitrato (NO3 -), nitrito (NO2 -), Fe +3 y azufre elemental (S) como aceptores terminales de electrones. Otros iones, como Mn +4, Co +3, Cr +6 y U +6, también son reducidos por algunas cepas. La mayoría de las cepas positivas para oxidasa son positivas para catalasa. La menaquinona 8 es la quinona respiratoria predominante. La ornitina es el principal diaminoácido del peptidoglicano. Un fosfolípido principal está presente en todas las cepas. También están presentes uno o dos glicolípidos principales. Los fosfolípidos y los glicolípidos se basan principalmente en glicerol, pero algunos organismos también poseen lípidos a base de 1,2-diol. Los ácidos grasos son predominantemente Yo asi- y anteiso-Algunas cepas ramificadas poseen 3-hidroxiácidos grasos y 2-hidroxiácidos grasos. La familia Thermaceae representa un linaje distinto dentro del filo "Deinococcus-Thermus" y las especies de la familia comparten similitudes en la secuencia del gen del ARNr 16S en el rango de 80,0 a 89,4% con otros taxones del filo. Aislado y detectado en áreas hidrotermales terrestres y marinas con pH neutro a alcalino, también comúnmente aislado de ambientes térmicos artificiales.

Contenido de ADN G + C (% en moles): 60.9–71.3 (T metro o HPLC).

Tipo de género: Thermus Brock y Freeze 1969, 295 AL. emend Nobre, Trüper y da Costa 1996, 605.


Cofactores

Leonardo Sorci,. Andrei L. Osterman, en Comprehensive Natural Products II, 2010

7.08.3.1.1 Vías biosintéticas

NaMN es el mononucleótido intermedio (un concentrador) más común en la biogénesis de NAD. Por ejemplo, en E. coli los tres precursores de piridina se convierten en NaMN ( tabla 1 y Figura 3 (a) ). Qa producido por el de novo Vía Asp-DHAP (genes nadB y nadA) se convierte en NaMN por QAPRT (gen nadC). El rescate de ambas formas de niacina se realiza mediante NAPRT (gen pncB) directamente sobre o después de la desamidación por NMDSE (gen pncA). En general, más del 90% de aproximadamente 680 genomas bacterianos analizados contienen al menos una de las vías que conducen a la formación de NaMN. La mayoría de ellos (∼480 genomas) tienen el conjunto completo de nadBAC genes para NaMN de novo síntesis de Asp que a menudo se agrupan en el cromosoma y / o están co-reguladas por los mismos factores de transcripción (ver Sección 7.08.3.1.2). Entre los ejemplos proporcionados en tabla 1 , F. tularensis ( Figura 4 (c) ) tiene los tres genes de este de novo vía formando un solo grupo similar a un operón y apoyando el crecimiento de este organismo en ausencia de precursores de piridina en el medio. Más de la mitad de los genomas con la vía Asp-DHAP también contienen una vía de rescate de niacina desamidante (genes pncAB) al igual que muchos representantes de las proteobacterias α, β y γ, actinobacterias y el grupo Bacillus / Clostridium. Como ya se enfatizó, el enfoque de reconstrucción genómica proporciona una evaluación del potencial metabólico de un organismo, que puede o no realizarse en determinadas condiciones. Por ejemplo, E. coli y B. subtilis puede utilizar ambos de novo y las vías de rescate de PncAB Nm en las mismas condiciones de crecimiento, mientras que en M. tuberculosis (que tiene el mismo patrón de genes) la última vía se consideró no funcional, por lo que todo el grupo de NAD es generado por el de novo Ruta NadABC. Sin embargo, un estudio reciente demostró la actividad funcional de la vía de rescate de Nm en vivo, en condiciones hipóxicas en macrófagos infectados. 221 Este estudio también implicó a las dos enzimas posteriores de la síntesis de NAD (NAMNAT y NADSYN) como dianas quimioterapéuticas atractivas para tratar las formas aguda y latente de tuberculosis.

En aproximadamente 100 especies, incluidas muchas cianobacterias (p. Ej., Synechococcus spp.), Bacteroidetes (p. ej., Clorobio spp.) y Proteobacterias (p. ej., Caulobacter crescentus, Zymomonas mobilis, Desulfovibrio spp., y Shewanella spp. que representan los grupos α, β, δ y γ, respectivamente), la vía Asp-DHAP es la única ruta hacia la biogénesis de NAD. Entre ellos, casi todos Helicobacter spp. (excepto H. hepaticus), contienen solo los dos genes nadA y nadC pero carece del primer gen de la vía (nadB), que probablemente sea un tema de reemplazo de genes no autólogos. Un caso de reemplazo de NadB (ASPOX) por la enzima ASPDH en T. maritima (y arqueas metanogénicas) se discutió en la Sección 7.08.2.1. Sin embargo, no se pudieron identificar ortólogos de la ASPDH establecida en Helicobacter spp. así como en aproximadamente otras 15 especies bacterianas diversas que tienen la nadAC pero falta el nadB gen (por ejemplo, todos analizados Corynebacterium spp. excepto por C. diphtheriae). Por lo tanto, la identidad de la enzima ASPOX o ASPDH en estas especies aún se desconoce, lo que representa uno de los pocos casos restantes de "genes faltantes localmente" 220 en el subsistema NAD. Todas las demás especies bacterianas contienen tanto el nadA y nadB genes (más nadC) o ninguno.

En un número limitado de bacterias (alrededor de 20 especies), principalmente en los dos grupos distantes de Xanthomonadales (dentro de γ-Proteobacteria) y Flavobacteriales (dentro de Bacteroidetes), la vía Asp-DHAP de la síntesis de Qa es reemplazada por la vía Kyn. Como se describe en la Sección 7.08.2.1.2, cuatro de cada cinco enzimas (TRDOX, KYNOX, KYNSE y HADOX) en la versión bacteriana de esta vía son homólogos cercanos de las respectivas enzimas eucariotas, mientras que el gen KYNFA es un sujeto de múltiples reemplazos no ortólogos. Aunque la identidad de una forma alternativa de KYNFA (gen kynB) se estableció en un grupo de bacterias que tienen una vía Kyn parcial para la degradación de Trp para antranilato (p. ej., en P. aeruginosa o B. cereus 57), ninguno de los homólogos de KYNFA conocidos está presente en Xanthomonadales o Flavobacteriales. En unas pocas especies (por ejemplo, Salinispora spp.), un conjunto completo de genes de la vía Kyn coexiste con una vía Asp-DHAP completa. Se necesitarían más experimentos para establecer en qué medida y en qué condiciones estas dos vías contribuyen a la formación de Qa. Como se discutió, la enzima QAPRT es compartida por ambos de novo vías, y un gen respectivo, nadC siempre se encuentra en los genomas que contienen una u otra vía. Del mismo modo, el gen nadC siempre co-ocurre con Qa de novo genes biosintéticos con una notable excepción de dos grupos de estreptococos, S. pneumonaie y S. pyogenes. Aunque todos los demás miembros del grupo Lactobacillales también carecen del Qa de novo maquinaria biosintética y dependen completamente del rescate de niacina, solo estos dos patógenos humanos contienen un nadC gene. Se desconoce la importancia funcional de este gen "fuera de contexto", pero es tentador especular que puede estar involucrado en una vía aún desconocida de rescate de Qa del huésped humano.

Entre aproximadamente 150 especies bacterianas que carecen de novo genes de biosíntesis y se basan en el rescate desamidante de niacina (a través de NAPRT), la mayoría (100) son del grupo de Firmicutes. Tal variante funcional (ilustrada para Staphylococcus aureus en Figura 4 (b) ) es característico de muchos patógenos bacterianos, tanto grampositivos como gramnegativos (p. ej., Brucella, Bordetella, y Campylobacter spp. de α-, β- y δ-Proteobacteria, Borrelia, y Treponema spp. de Spirochaetes). La mayoría de los genomas de este grupo contienen tanto pncA y pncB genes que a menudo se agrupan en el cromosoma y / o están co-regulados (consulte la Sección 7.08.3.1.2). En algunos casos (por ejemplo, dentro de Mollicutes y Spirochaetales), solo el pncB, pero no el pncA gen, se puede identificar de manera confiable, lo que sugiere que cualquiera de estas especies puede utilizar solo la forma desamidada de niacina (Na) o que algunas de ellas contienen una NMASE alternativa (aún desconocida).

Aunque la conversión no desamidante de Nm en NMN (vía NMPRT) parece estar presente en aproximadamente 50 especies bacterianas (principalmente en β- y γ-Proteobacteria), casi nunca es la única vía de biogénesis de NAD en estos organismos. La única excepción posible se observa en Mycoplasma genitalium y M. pneumoniae que contienen el nadV gen como el único componente de la maquinaria biosintética de mononucleótidos de piridina. En algunas especies (por ejemplo, en Sinecocistes spp.), la ruta NMPRT-NMNAT se dedica principalmente al reciclaje de Nm endógeno. Por otro lado, en F. tularensis ( Figura 4 (c) ), NMPRT (gen nadV) junto con NMNAT (del nadM familia) constituyen la vía de rescate funcional no desamidante de Nm, ya que apoya el crecimiento de la nadE′ -Mutante en Nm pero no en Na (L. Sorci et al., inédito). Una vía de rescate de Nm no desamidante similar implementada por NMPRT y NMNAT (de la nadR familia) está presente en algunas (pero no en todas) especies de Pasteurellaceae además (pero nunca en lugar de) la vía de rescate de RNm (ver más abajo), como se demostró inicialmente para H. ducreyi. 128

Una conversión de dos pasos de NaMN en NAD a través de un intermedio de NaAD (Ruta I en Figura 2 ) está presente en la inmensa mayoría de las bacterias. La enzima característica de la Ruta I, NAMNAT de la familia NadD, está presente en casi todas las aproximadamente 650 especies bacterianas que se espera que generen NaMN a través de de novo o vías de salvamento (como lo ilustra Figuras 3 (a) y 3 (b) ). Todas estas especies, sin una sola excepción, también contienen NADSYN (codificado por una forma corta o larga de la nadE gen), que se requiere para esta ruta. Las especies que carecen de la firma NadD / NadE representan varias variantes funcionales relativamente raras, que incluyen:

Ruta I de síntesis de NAD (NaMNNaADNAD) variante a través de una enzima bifuncional NAMNAT / NMNAT de la familia NadM es común para las arqueas (ver Sección 7.08.3.2), pero parece estar presente solo en un puñado de bacterias, como Acinetobacter, Deinococcus , y Thermus grupos. Otra característica inusual de los dos últimos grupos es la ausencia del NADKIN clásico, un tema probable de un reemplazo no ortólogo que aún no se ha dilucidado.

Ruta II de síntesis de NAD (NaMNNMNNAD). Esta ruta se implementa mediante una combinación de NMNAT de la familia NadM (como en F. tularensis) o la familia NadR (como en M. succinoproducens y A. succinogenes) con NMNSYN de la familia NadE ′. El caso de F. tularensis descrito en la Sección 7.08.2.4 se ilustra en Figura 3 (b) . El resto de la maquinaria biosintética de NAD en ambas especies del grupo Pasteurellaceae, más allá de la Ruta II compartida, es notablemente diferente a la de F. tularensis. En lugar de de novo biosíntesis, albergan una vía de rescate de Na a través de NAPRT codificada por un pncB gen que está presente en un grupo cromosómico con nadE′. Ninguno de estos dos genes está presente en otras Pasteurellaceae que carecen de la maquinaria de amidación de carboxilato de piridina (ver más abajo).

Salvamento de RNm (RNmNMNNAD). Una firma genómica de esta vía, una combinación del transportador tipo PnuC y un NMNAT / RNMKIN bifuncional de la familia NadR, está presente en muchas Enterobacteriaceae y en varias otras especies diversas (p. Ej., En M. tuberculosis). Sin embargo, en H. influenzae ( Figura 3 (d) ) y miembros relacionados de Pasteurellaceae, es la única vía de biogénesis de NAD. Como se muestra en tabla 1 , H. influenzae así como muchos otros miembros de este grupo han perdido casi todos los componentes de la rica maquinaria biosintética de NAD que están presentes en sus vecinos filogenéticos cercanos (como E. coli y muchas otras Enterobacteriaceae). Esta vía es una vía definitiva para la utilización de los denominados factores V (NADP, NAD, NMN o RNm) que se requieren para apoyar el crecimiento de H. influenzae. Se estableció que todos los demás factores V se degradan a RNm por una combinación de enzimas hidrolíticas periplásmicas y asociadas a la membrana. 222 Aunque PnuC se consideró inicialmente un transportador de NMN, 223 su reciente análisis detallado en ambos H. influenzae y Salmonella confirmó que su función fisiológica real está en la captación de RNm junto con la fosforilación de RNM a NMN por RNMKIN. 17,148,224 Como ya se mencionó, H. ducreyi y varios otros miembros independientes del factor V del grupo Pasteurellaceae (H. somnus, Actinobacillus pleuropneumoniae, y Actinomycetemcomitans) albergan la enzima NMNAT (NadV) que les permite crecer en presencia de Nm (pero no Na) en el medio (Sección 7.08.2.2).

Captación del NAD intacto. Varios grupos de endosimbiontes intracelulares filogenéticamente distantes con genomas extremadamente truncados contienen solo una enzima, NADKIN, de todo el subsistema. Entre ellos se encuentran todas las especies analizadas del Wolbachia, Rickettsia, y Blochmannia grupos. Se espera que estas especies absorban y utilicen el NAD intacto de su hospedador mientras conservan la capacidad de convertirlo en NADP. Entre todas las bacterias analizadas, solo el grupo de Clamidia no tiene NADKIN y depende de la recuperación tanto de NAD como de NADP a través de un sistema de absorción único. 157

Una reconstrucción genómica completa del potencial metabólico (anotaciones genéticas y vías afirmadas) en aproximadamente 680 genomas bacterianos diversos prepara el escenario para la proyección precisa del genoma cruzado y la predicción de los mecanismos reguladores que controlan la realización de este potencial en una variedad de especies y crecimiento. condiciones. En la siguiente sección, resumimos los logros recientes en la reconstrucción genómica de regulones relacionados con NAD en bacterias.


Métodos

Cepas y condiciones de crecimiento bacteriano

D. geotermalis DSM 11302 y D. murrayi Los DSM 11303 se adquirieron de Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Alemania). Se cultivaron en 50 ml de medio Luria-Bertani modificado pH 7,2 que contenía 1 g de peptona K, 1 g de extracto de levadura y 7,4 g de sal marina en 1000 ml de agua destilada. D. geotermalis se cultivó durante 30 ha 50 ° C y D. murrayi se cultivó durante 30 ha 47 ° C. Posteriormente, se aisló el ADN genómico usando Genomic Mini AX Bacteria (A & ampA Biotechnology, Polonia).

Clonación del D. geothermalis recA gene

los recA gen fue amplificado por PCR usando ADN genómico de D. geotermalis DSM 11302 como plantilla. Los cebadores utilizados fueron: DGRAFNde 5 'CGAGATO ATG AGCAAGGAACAACCCCAAGGA 3 ', que contiene el sitio de reconocimiento para Nde I endonucleasa (subrayado) y DGRARHnd 5 'ACAAAGC TT A CTCTGCCAAGGCGGGC 3 ', que contiene el sitio de reconocimiento para Hin endonucleasa dIII (subrayada). Los codones de inicio y finalización están en negrita. La mezcla de reacción constaba de 0,13 μg de D. geotermalis ADN, 0,2 μM de cada cebador, 200 μM de cada dNTP, MgSO 2 mM4 y 1 U de Delta3 ADN polimerasa (ADN-Gdańsk, Polonia) en 1 × tampón de PCR (Tris-HCl 20 mM, pH 8,8, KCl 10 mM, (NH4)2ASI QUE4, Triton X-100 al 0,1%). La reacción de PCR se realizó usando las siguientes condiciones: 95 ° C - 2 min, (95 ° C - 1 min, 61 ° C - 1 min, 72 ° C - 1 min 30 ciclos), 72 ° C - 5 min. El producto de PCR se clonó en el vector pCR-Blunt (Invitrogen, Carlsbad, California, EE.UU.) y se secuenció. El pCR-Blunt-NdeI- obtenidoDge El plásmido RecA-HindIII luego se digirió con Nde yo y Hin dIII endonucleasas, y el fragmento de ADN que contiene el recA El gen se clonó en el vector de expresión pET-30 Ek / LIC (Novagen, Beeston, Nottingham, Inglaterra) digerido con las mismas enzimas de restricción. El plásmido recombinante resultante pET-30Ek / LIC-Dge RecA se utilizó para la producción de D. geotermalis Proteína RecA en E. coli.

Aislamiento y clonación del D. murrayi recA gene

Para obtener una parte interna del recA gen de D. murrayi DSM 11303, secuencias que codifican proteínas RecA de Deinococcus geothermalis DSM 1300, D. geothemalis DSM 11302, Deinococcus radiodurans R1, Thermus aquaticus YT-1, Thermus thermophilus HB8 y T. thermophilus Los HB27 obtenidos de la base de datos GenBank se alinearon utilizando el programa ClustalX, versión 1.8. Basándose en la alineación, se diseñaron y sintetizaron los cebadores degenerados InvRecA1 5 'GAGTCSGGSGGCAAGACCAC 3' e InvRecA2 5 'TCCTTSCCCTGGCCSAKGC 3'. La reacción de PCR se realizó en la mezcla que contenía: 0,2 μM de cada cebador, 0,2 μg de D. murrayi ADN genómico DSM 11303, 200 μM de cada dNTP, MgCl 3 mM2 y 1 U de ADN polimerasa Hypernova (DNA-Gdańsk, Polonia) en tampón 1x Hypernova (Tris-HCl 10 mM, pH 8,8, KCl 50 mM, Triton X-100 al 0,15%). La mezcla de reacción se incubó durante 2 min a 95 ° C, seguido de 30 ciclos a 95 ° C durante 1 min, 59 ° C durante 1 min, 72 ° C durante 1 min y una incubación final durante 5 min a 72 ° C. . A continuación, el producto de PCR obtenido se purificó a partir de una banda de gel de agarosa usando el kit Gel-Out (A & ampA Biotechnology, Polonia), se clonó en el kit de clonación de PCR CloneJET ™ PCR pJET1.2 / vector contundente (Fermentas, Vilnius, Lituania) y se secuenció. Posteriormente, se realizó la PCR inversa para la obtención de regiones flanqueantes. los D. murrayi El ADN genómico se digirió por primera vez con Dra. I endonucleasa de restricción y luego fragmentos de restricción se ligaron sobre sí mismo para formar círculos. En el segundo paso, la amplificación por PCR se realizó utilizando productos de ligación como plantilla y dos cebadores: recAInvFor 5 'CCGCAAGATTGGGCAGCCCGTCAAGA 3' y recAInvRev 5 'ACCCGACCGCACGAGCAGCTCCATG 3', diseñado a partir de la secuencia parcial obtenida previamente de D. murrayi recA gene. La mezcla de reacción contenía también 200 μM de cada dNTP, MgCl 3 mM2 y 1 U de ADN polimerasa Hypernova (DNA-Gdańsk, Polonia) en tampón 1x Hypernova. La amplificación del ADN se realizó utilizando las siguientes condiciones: 95 ° C - 3 min, (95 ° C - 1,5 min, 66 ° C - 1 min, 72 ° C - 5 min) 30 ciclos y 72 ° C - 15 min después de la final ciclo. El producto de la PCR se purificó a partir de una banda de gel de agarosa, se clonó en el vector pJET1.2 / blunt y se secuenció. Posteriormente, fragmentos de D. murrayi secuencia de ADN genómico fueron alineación y la secuencia completa de recA se obtuvo el gen.

los D. murrayi DSM 11303 recA Luego se amplificó el gen usando el cebador directo FDMRecANdeI 5 'ATTAGATO ATG AGCAAGGACAACCCCAAGGACTTC 3 ', y el cebador inverso RDMRecAXhoI 5' TATTCTCGAG TTA CTCCGCGACAGCGGGCAC 3 ', que contiene Nde yo y Xho I sitios de reconocimiento, respectivamente (subrayados). Los codones de inicio y finalización están en negrita. La mezcla de reacción de PCR contenía: 0,2 μM de cada cebador, 0,2 μg de D. murrayi ADN genómico, 200 μM de cada dNTP, MgCl 3 mM2 y 1 U de ADN polimerasa Hypernova (DNA-Gdańsk, Polonia) en 1 × Hypernova buffer. La mezcla de reacción se incubó durante 3 min a 96 ° C, seguido de 5 ciclos a 95 ° C durante 1 min, 58 ° C durante 1 min, 72 ° C durante 1 min y 25 ciclos a 95 ° C durante 1 min, 63 ° C durante 1 min, 72 ° C durante 1 min y una incubación final durante 5 min a 72 ° C. Posteriormente, el producto de la PCR se purificó a partir de una banda de gel de agarosa, se clonó en el vector pJET1.2 / blunt y se secuenció. El pJET-NdeI- obtenidoDmu El plásmido RecA-XhoI luego se digirió con Nde yo y Xho I endonucleasas, y el fragmento de ADN que contiene el recA El gen se clonó en el vector de expresión pET-30 Ek / LIC (Novagen) digerido con las mismas enzimas de restricción. El plásmido recombinante resultante pET-30Ek / LIC-Dmu RecA se utilizó para la producción de D. murrayi Proteína RecA en E. coli.

Producción y purificación de recombinantes Dge RecA y Dmu Proteínas RecA

Sobreproducción de Dge RecA y Dmu Las proteínas RecA se realizaron en el E. coli Células BLR (DE3) (Novagen) que llevan el pET-30Ek / LIC-Dge RecA o pET-30Ek / LICDmu Plásmidos RecA. Las células se cultivaron a 37ºC en 750 ml de medio LB (peptona K al 1%, extracto de levadura al 0,5%, NaCl al 1%) que contenía 20 µg / ml de kanamicina. En OD600 Se añadió 0,5 IPTG a la concentración final de 1 mM y se continuó el cultivo durante 4 horas. Posteriormente, los cultivos se centrifugaron (4612 × gramo, 10 min, 4 ° C) y los sedimentos se resuspendieron en 75 ml de tampón A1 (Tampón de fosfato de potasio 20 mM pH 6,0, KCl 50 mM, EDTA 1 mM, DTT 1 mM) en el caso de Dge Producción de proteína RecA o tampón A2 (Tampón de fosfato de potasio 20 mM pH 6,5, KCl 50 mM, EDTA 1 mM, DTT 1 mM) para Dmu RecA. Las muestras se sonicaron siete veces durante 30 sa 0 ° C y se centrifugaron (4612 × gramo, 10 min, 4 ° C). El sobrenadante que contiene Dge La proteína RecA se trató térmicamente a 60 ° C durante 20 min, se enfrió en hielo y se centrifugó nuevamente (18000 × gramo, 30 min, 4 ° C).

Dge RecA y Dmu A continuación, las proteínas RecA se purificaron utilizando una columna Fractogel EMD DEAE (Merck, Darmstadt, Alemania) equilibrada con tampón A1 o A2, respectivamente. Las proteínas RecA se eluyeron con un gradiente lineal de KCl 0,05-1,5 M en el tampón apropiado. Fracciones que contienen D. geotermalis o D. murrayi RecA se combinaron, se dializaron contra tampón A1 o A2 y cargado en la columna ResourceQ (Amersham Biosciences AB, Uppsala, Suecia). La elución se realizó mediante un gradiente lineal de KCl 0,05-0,425 M en tampón A1 o A2. Las fracciones que contenían proteínas RecA se dializaron contra tampón A1 o A2 una vez más y se purificó usando una columna MonoQ (Amersham Biosciences AB). Dge RecA y Dmu RecA se eluyó con un gradiente lineal de KCl 0,05-0,35 M en tampón apropiado. Las fracciones recolectadas que contenían proteínas RecA purificadas se verificaron luego para detectar contaminaciones de nucleasas incubándolas con ADN RFI M13mp18 (24 μM de nucleótidos), ADNdc lineal M13mp18 (24 μM de nucleótidos) y ADNss circular M13mp18 (12 μM de nucleótidos) en el potasio 20 mM. tampón de fosfato pH 7,5 que contiene MgCl 10 mM2. La concentración de proteínas RecA fue de 10 µM. Las mezclas de reacción se incubaron a 37 ° C durante 2 hy luego se añadieron EDTA, SDS y Proteinasa K a las concentraciones finales de 10 mM, 1% y 2 mg / ml, respectivamente. Las muestras se incubaron a temperatura ambiente durante 30 min y se separaron por electroforesis en geles de agarosa al 1% con bromuro de etidio. Los ADN también se incubaron solo con proteinasa K, como muestra de control. No observamos ninguna actividad exo o endonucleasa ni en las preparaciones de proteínas RecA ni en la proteinasa K. Posteriormente, las proteínas RecA se dializaron contra 100 mM (NH4) HCO3 y liofilizado para un almacenamiento prolongado.

La pureza de las proteínas se investigó mediante SDS-PAGE. La concentración de proteínas RecA en cada paso de producción y purificación se midió mediante el método de Bradford [54]. La concentración de proteína en las muestras para pruebas bioquímicas fue determinada por A280 nm utilizando un coeficiente de extinción de 11,920 M -1 cm -1, que se calculó a partir de las secuencias de aminoácidos de Dge RecA y Dmu Proteínas RecA.

Estimación de la masa molecular nativa

La masa molecular de Dge RecA y Dmu Las proteínas RecA se estimaron usando cromatografía de filtración en gel analítica. Se cargaron muestras que contenían diversas concentraciones de proteínas purificadas en una columna Superdex 200 HR 10/30 (Amersham Biosciences AB) equilibrada con tampón de fosfato de potasio 25 mM pH 7,5 que contenía KCl 1,0 M y se eluyeron con el mismo tampón a una velocidad de flujo de 0,5 ml / min. . Los perfiles de elución se controlaron registrando la absorbancia a 214 nm. Los pesos moleculares de Dge RecA y Dmu Los oligómeros de RecA se determinaron por comparación con los de las proteínas estándar: tiroglobulina (669 kDa), apoferritina (443 kDa), β-amilasa (200 kDa), alcohol deshidrogenasa (150 kDa), albúmina de suero bovino (66 kDa) y anhidrasa de carbono ( 29 kDa).

Actividad de unión del ssDNA

La habilidad de Dge RecA y Dmu Las proteínas RecA para unirse al ssDNA se investigaron mediante el cambio de movilidad electroforética de oligo marcado con fluoresceína en el extremo 5 '(dT)35 nucleótidos. 25 μl de mezclas de reacción que contienen 5,6 μM (nucleótidos) oligo (dT)35, 110 μM ATP-γ-S, 300 μM ATP, de 0 a 10 mM MgCl2 y proteína RecA 9 µM en tampón fosfato de potasio 20 mM pH 7,5 se incubaron a 25-75ºC durante 30 min en la oscuridad. Posteriormente, las muestras se separaron mediante electroforesis en geles de agarosa al 0,8%. Los resultados se visualizaron utilizando un transiluminador UV.

Actividad de unión de dsDNA

La habilidad de Dge RecA y Dmu Las proteínas RecA para unirse a dsDNA se investigaron por cambio de movilidad electroforética de producto de PCR de 600 pb (λ DNA amplificado usando cebadores 5 'GGACAAGGTCGCTGAAGCCTTCG 3' y 5 'TCCTGACGGGCGGTATATTTCTCC 3'). 25 μl de mezclas de reacción que contienen 30 μM (nucleótidos) de dsDNA o 30 μM de dsDNA y 14 μM de ssDNA (oligo marcado con fluoresceína en el extremo 5 '(dT)35), ATP-γ-S 180 μM, ATP 500 μM, MgCl 0 o 10 mM2 y proteína RecA 12 µM en tampón de fosfato de potasio 20 mM pH 7,5 se incubaron a 37ºC durante 30 min. Posteriormente, las muestras se separaron mediante electroforesis en geles de agarosa al 0,8% que contenían bromuro de etidio. Los resultados se visualizaron utilizando un transiluminador UV.

Termoestabilidad de las proteínas RecA

La termoestabilidad de Dge RecA y Dmu RecA se determinó mediante la actividad de unión del ssDNA después de la incubación de proteínas a diversas temperaturas durante un conjunto de períodos de tiempo. Las muestras que contienen proteína RecA 11,8 μM y MgCl 0 o 10 mM2 en tampón de fosfato de potasio 20 mM pH 7,5 se incubaron a 50-80 ° C durante 10 sa 180 min, se enfriaron en hielo y se centrifugaron (13500 × gramo, 10 minutos). Luego se tomaron alícuotas (19 μl) y oligo marcado con fluoresceína en el extremo 5 '(dT)35 nucleótidos, ATP, ATP-γ-S y MgCl2 se agregaron a las concentraciones de 5,6 μM, 300 μM, 110 μM y 10 mM en el volumen final de 25 μl, respectivamente. Posteriormente, las mezclas de reacción se incubaron a 37 ° C durante 30 min en la oscuridad y se separaron por electroforesis en geles de agarosa al 0,8%. Los resultados se visualizaron utilizando un transiluminador UV.

Ensayo de ATPasa

Hidrólisis de ATP (o dATP) por Dge RecA y Dmu RecA se controló mediante un método acoplado a enzimas.La regeneración de ATP a partir de ADP y fosfoenolpiruvato catalizada por piruvato quinasa se acopló con la conversión de NADH en NAD + catalizada por lactato deshidrogenasa, que se controló mediante una disminución de la absorbancia a 355 nm. La absorbancia se midió usando el lector de placas de múltiples etiquetas PerkinElmer Victor 3 V (Centro de Excelencia ChemBioFarm, Universidad Tecnológica de Gdańsk, Gdańsk, Polonia).

Las mezclas de reacción consistieron en: proteína RecA 3,03 μM, MgCl 11,56 mM2, 1,25 U de lactato deshidrogenasa de músculo de conejo, 0,75 U de piruvato quinasa de músculo de conejo, NADH 3,3 mM, PEP 2,27 mM, ATP 0,38-2,27 mM (o dATP) y tampón Tris-HCl 20 mM pH 7,5 hasta el volumen final de 75 μl. Las reacciones se llevaron a cabo en ausencia de ADN y en presencia de 12,16 μM (nucleótidos) ssDNA del oligonucleótido SygB1a 5 'CGTTCGAAACGATGAGGAAGACTTATTGGCTGATGGCGCTTTTCGCGGTGCTCATGTTCCCTGAAAAGTGCTCATGTTCCCTGAAAAGTT Xba DsDNA linealizado con I del plásmido pBADTOPOβAQa (5727 pb) que contiene la secuencia complementaria del oligonucleótido SygB1a. Las reacciones de hidrólisis de ATP (o dATP) se realizaron a 32, 37, 42, 45 y 50 ° C.

Reacciones de intercambio de hebras de ADN

Se llevaron a cabo reacciones de intercambio de cadena de ADN dependiente de RecA entre ADNss circular de M13mp18 y ADNds lineal de M13mp18 obtenido por Sma Yo digestión. Todas las reacciones se llevaron a cabo en soluciones que contenían tampón Tris-HCl 20 mM pH 7,5, proteína RecA 5 μM, ssDNA 9 μM (nucleótidos), dsDNA 18 μM (nucleótidos), 0,3 μM Dge Proteína SSB [44], DTT 1,2 mM, MgCl 10 mM2, 3 mM de ATP y un sistema de regeneración de ATP (0,5 U de piruvato quinasa de músculo de conejo, 3 mM de fosfoenolpiruvato) en 25 μl. Una preincubación de ssDNA con Dge RecA a 45 ° C o con Dmu RecA a 42 ° C durante 5 min fue seguido por la adición de ATP o dATP y SSB. Después de una incubación adicional de 5 min, se añadió dsDNA lineal para iniciar las reacciones de intercambio de hebras. Las reacciones se llevaron a cabo a 45 ° C cuando Dge Se utilizó RecA oa 42 ° C en el caso de Dmu RecA durante 15, 30, 45, 60, 75 y 90 min y se detuvo mediante la adición de EDTA, SDS y proteinasa K hasta las concentraciones finales de 10 mM, 1% y 2 mg / ml, respectivamente. Las muestras se incubaron a temperatura ambiente durante 30-90 min y luego se separaron por electroforesis en geles de agarosa al 0,8%. Los resultados se visualizaron y fotografiaron con luz ultravioleta usando el sistema de imágenes VersaDoc ™ (Bio-Rad Laboratories, Hercules, California, EE.UU.) después de teñir los geles con bromuro de etidio. Las bandas de ADN se cuantificaron con el software Cantidad Uno, versión 4.3.1 (Bio-Rad Laboratories). La banda correspondiente al producto de dsDNA circular con muescas se cuantificó como la fracción del ADN total en una línea de gel determinada, excluyendo la banda correspondiente al ssDNA. En el caso de reacciones inversas de intercambio de cadenas de ADN, las proteínas RecA se preincubaron con el ADN bicatenario lineal y ATP o dATP durante 15-60 min. A continuación, se añadió el ssDNA para iniciar las reacciones y se añadió SSB 5 minutos más tarde.